Microwave sputtering of conductors and insulators for optical emission and mass spectrometry

A microwave-powered slab-line cavity was used to excite a discharge in low pressure argon or neon and to demonstrate the sputtering of conducting and non-conducting samples by a microwave excited discharge. Both optical emission spectroscopy and mass spectrometry were used as detection systems. The dependence of the signals on gas pressure and net microwave power was investigated.     

Kerr-nonlinearity optical parametric oscillation in an ultrahigh-Q toroid microcavity

Kerr-nonlinearity induced optical parametric oscillation in a microcavity is reported for the first time. Geometrical control of toroid microcavities enables a transition from stimulated Raman to optical parametric-oscillation regimes. Optical parametric oscillation is observed at record low threshold levels (174 micro-Watts of launched power) more than 2 orders of magnitude lower than for optical-fiber-based optical parametric oscillation. In addition to their microscopic size (typically tens of microns), these oscillators are wafer based, exhibit high conversion efficiency (36%), and are operating in a highly ideal "two photon" emission regime, with near-unity (0.97+/-0.03) idler-to-signal ratio.     

Photoinduced hydrogen isotope exchange in anisole and toluene

Photochemical electrophilic aromatic substitution processes in deuterated and tritiated anisoles and toluenes have been examined. Valence isomerization did not occur in anisole on irradiation. The relative reactivities of the ortho, meta and para positions in toluene are 2:1:1·4 respectively, differing from those in the ground state. Up to 51% exchange has been observed for o-D-toluene and up to 30% exchange for o-D-anisole after 8 h irradiation. Extensive photodecomposition occurs under all conditions with anisole but is slower with toluene. Comparison of the observed substitution pattern of toluene with excited state electron distributions points to the involvement of the second excited singlet and first excited triplet states in the photochemical hydrogen exchange process.     

Dinuclear ruthenium(ii) complexes with flexible bridges as non-duplex DNA binding agents

The stereoisomers of a series of dinuclear ruthenium(ii) complexes [{Ru(phen)(2)}(2)(micro-BL)](4+) (phen = 1,10-phenanthroline) with flexible bridging ligands (BL) bb2 {1,2-bis[4(4'-methyl-2,2'-bipyridyl)]ethane}, bb5 {1,5-bis[4(4'-methyl-2,2'-bipyridyl)]pentane}, bb7 {1,7-bis[4(4'-methyl-2,2'-bipyridyl)]heptane}, and bb10 {1,10-bis[4(4'-methyl-2,2'-bipyridyl)]decane} have been synthesised. Their binding to a control dodecanucleotide, d(CCGGAATTCCGG)(2), and a tridecanucleotide, d(CCGAGAATTCCGG)(2), which contains a single adenine bulge have been studied using fluorescence displacement assays involving intercalating and groove-binding dyes, equilibrium dialysis and binding affinity chromatography. The fluorescence intercalator displacement (FID) assay indicated that LambdaLambda-[{Ru(phen)(2)}(2)(micro-bb7)](4+) had the greatest binding affinity with all the oligonucleotides, whereas an analogous fluorescence technique using a minor-groove binding dye, equilibrium dialysis and affinity binding chromatography showed that DeltaDelta-[{Ru(phen)(2)}(2)(micro-bb7)](4+) had the strongest binding. An (1)H NMR study of the binding of the DeltaDelta-enantiomer of [{Ru(phen)(2)}(2)(micro-bb7)](4+) to d(CCGAGAATTCCGG)(2) confirmed the selectivity of the metal complex for the bulge site and provided the basis for an energy-minimised binding model of the dinuclear ruthenium complex with the single adenine bulge containing trinucleotide. The binding model demonstrated the ability of the flexibly-linked complex to follow the curvature of the DNA minor groove.     

Phase - transfer catalyser hydrogen-deuterium exchange in thiazoles.

phase transfer catalysis has been used for the first time in a reaction of hydrogen deuterium exchange in heterocyclic chemistry. The method provide a good synthetic path for the synthesis of D - 2 thiazoles by direct exchange. Moreover, even with substituents such as t-butyl, hydrogen exchange on positions adjacent to the alkyl group occured.     

Investigation of the influence of high-risk human papillomavirus on the biochemical composition of cervical cancer cells using vibrational spectroscopy

The main aetiology of cervical cancer is infection with high-risk human papillomavirus (HPV). Cervical cancer is almost 100% curable if detected in the early stages. Thus, information about the presence and levels of HPV in patient samples has high clinical value. As current screening methods, such as the Pap smear test, are highly subjective and in many cases show low sensitivity and specificity, new supportive techniques are desirable to improve the quality of cervical cancer screening. In this study, vibrational spectroscopic techniques (Raman and Fourier Transform Infra Red absorption) have been applied to the investigation of four cervical cancer cell lines: HPV negative C33A, HPV-18 positive HeLa with 20-50 integrated HPV copies per cell, HPV-16 positive SiHa with 1-2 integrated HPV strands per cell and HPV-16 positive CaSki containing 60-600 integrated HPV copies per cell. Results show that vibrational spectroscopic techniques can discriminate between the cell lines and elucidate cellular differences originating from proteins, nucleic acids and lipids. Similarities between C33A and SiHa cells were exhibited in the Raman and infrared spectra and were confirmed by Principal Component Analysis (PCA). Analysis of the biochemical composition of the investigated cells, with the aid of PCA, showed a clear discrimination between the C33A-SiHa group and HeLa and CaSki cell lines indicating the potential of vibrational spectroscopic techniques as a support to current methods for cervical cancer screening.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Isotope ratio monitoring gas chromatography/Mass spectrometry of D/H by high temperature conversion isotope ratio mass spectrometry

Of all the elements, hydrogen has the largest naturally occurring variations in the ratio of its stable isotopes (D/H). It is for this reason that there has been a strong desire to add hydrogen to the list of elements amenable to isotope ratio monitoring gas chromatography/mass spectrometry (irm-GC/MS). In irm-GC/MS the sample is entrained in helium as the carrier gas, which is also ionized and separated in the isotope ratio mass spectrometer (IRMS). Because of the low abundance of deuterium in nature, precise and accurate on-line monitoring of D/H ratios with an IRMS requires that low energy helium ions be kept out of the m/z 3 collector, which requires the use of an energy filter. A clean mass 3 (HD(+.)) signal which is independent of a large helium load in the electron impact ion source is essential in order to reach the sensitivity required for D/H analysis of capillary GC peaks. A new IRMS system, the DELTA(plus)XL(trade mark), has been designed for high precision, high accuracy measurements of transient signals of hydrogen gas. It incorporates a retardation lens integrated into the m/z 3 Faraday cup collector. Following GC separation, the hydrogen bound in organic compounds must be quantitatively converted into H(2) gas prior to analysis in the IRMS. Quantitative conversion is achieved by high temperature conversion (TC) at temperatures >1400 degrees C. Measurements of D/H ratios of individual organic compounds in complicated natural mixtures can now be made to a precision of 2 per thousand (delta notation) or, better, with typical sample amounts of approximately 200 ng per compound. Initial applications have focused on compounds of interest to petroleum research (biomarkers and natural gas components), food and flavor control (vanillin and ethanol), and metabolic studies (fatty acids and steroids). Copyright 1999 John Wiley & Sons, Ltd.