Adsorption of Pb(2+) ions on nanosized gamma-Fe(2)O(3): formation of surface ternary complexes on ligand complexation

Adsorption of Pb²⁺ ions on the combustion derived nanosized γ-Fe₂O₃ and its thiourea complex composite is reported. The adsorbents upon adsorption of Pb²⁺ ions are characterised by X-ray diffraction, scanning electron microscopy, energy dispersive X-ray microanalysis and infrared spectroscopy techniques. The eluent is characterised by atomic absorption spectroscopy for the estimation of Pb²⁺ ions. The reduction in the amount of lead after adsorption was estimated to be around 50% in case of complex composite adsorbent and around 15% in case of the γ-Fe₂O₃ adsorbents. Orthorhombic PbSO₄ precipitated out from the eluent and is reported with a model reaction. Adsorption of lead onto the complex composite is explained through the formation of a surface tertiary complex. The advantage of employing a thiourea-γ-Fe₂O₃ complex composite as solid adsorbent for the adsorption of heavy metal pollutants is envisaged in the present investigation.     

K α L 1 satellite multiplet structure of photon-excited chlorine atoms

Summary An attempt is made to study theK _α L ¹ satellite multiplet structure of chlorine atoms in different compounds by photon excitation. A comparison of the averageK _α L ¹ group energy shift from the diagram line with those based on Dirac-Fock evaluations with different number ofM-shell electrons shows a reasonable agreement. The intensity ratios are found to be higher than those studied in Mg compounds in general.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Direct spectrophotometric method for the determination of cobalt with indane 1,2,3-trionetrioxime in aqueous medium

A simple, sensitive and selective Spectrophotometric method has been developed for the determination of cobalt using indane 1,2,3-trionetrioxime (ITT): The method is based on the colour reaction between ITT and cobalt(II) in sodium acetate-acetic acid buffer (pH 4.5–7.5) medium. The calibration graph for measurement at 320 nm is linear in the range 1.18–23.60g of cobalt per 25 ml, with molar absorptivity of 5.32×10⁴1mol^–1 cm^–1. The effect of interfering ions has been studied and the method was applied to the determination of cobalt in alloys, with good results.     

Validated Chiral LC Method for the Enantiomeric Separation of β-Amino-β-(3-Methoxyphenyl) Propionic Acid

A chiral liquid chromatographic method for enantiomeric resolution of β-amino-β-(3-methoxyphenyl) propionic acid was developed and validated. The “hybrid” π-electron donor–acceptor based stationary phase (R,R) Whelk-01 was found to be enantiomerically selective for (R) and (S) enantiomers of β-amino-β-(3-methoxyphenyl) propionic acid with a resolution greater than 2.0. The effects of isopropyl alcohol and ethanol on enantioselectivity and resolution of enantiomers were evaluated. Calibration curves were linear over the range of 0.10–1.00, with a regression coefficient (r) of 0.999. The limit of detection (LOD) and limit of quantification (LOQ) were 300 and 1,000 ng mL⁻¹ respectively for 10 μL injection volume. The percentage RSD of the peak area of six replicate injections of (S) enantiomer at LOQ concentration was 2.8. The percentage recovery of (S) enantiomer from (R) enantiomer samples ranged from 92 to 102. The test solution was observed to be stable up to 24 h after the preparation. The developed normal phase chiral LC method can be used for the enantiomeric purity evaluation of R-β-amino-β-(3-methoxyphenyl) propionic acid.     

Sequence selective recognition in the minor groove of dsDNA by pyrrole,imidazole-substituted bis-benzimidazole conjugates

A series of pyrrole, imidazole-substituted bis-benzimidazole conjugates, Py-Py-Im-gamma-biBenz, Py-Py-gamma-biBenz, Py-Im-gamma-biBenz, and Im-Py-gamma-biBenz (1-4), were prepared in an attempt to target dsDNA sequences possessing both A/T and G/C bps. The dsDNA interactions and sequence specificity of the conjugates have been characterized via spectrofluorometric titrations and thermal melting studies. All conjugates form 1:1 complexes with dsDNA at subnanomolar concentrations. The Im moiety selectively recognizes a G/C bp embedded in the A/T-rich binding site. This represents the first clear example of sequence selective recognition in a 1:1 motif.(1) The equilibrium association constant (K(1)) for complexation of a specific nine-bp dsDNA site, 5'-gcggTATGAAATTcgacg-3', by conjugate 1 is approximately 2.6 x 10(9) M(-1). Displacement of the G/C position or G/C-->A/T substitution within the nine-bp site decreases the K(1) by approximately 8-fold, whereas two continuous G/C bps decrease the K(1) by approximately 50-fold magnitude. The K(1) values for seven-bp dsDNA, 5'-gcggtaTGAAATTcgacg-3' and 5'-gcggtaCAAAATTcgacg-3', binding sites by conjugates Py-Im-gamma-biBenz (3) and Im-Py-gamma-biBenz (4) are approximately 2.3 x 10(9) and approximately 1.2 x 10(9) M(-1), respectively. However, the conjugates with no Im moiety, Py-Py-gamma-biBenz (2) and Py-Py-Py-gamma-biBenz (5 and 6), are specific for seven- to nine-bp A/T-rich sites and single A/T-->G/C bp substitution within the binding site decreases the K(1) values by 1-2 orders of magnitude.     

Stereoselective total synthesis of (−)-brevisamide

The stereoselective total synthesis of (−)-brevisamide, a novel marine cyclic ether alkaloid isolated from dinoflagellate karenia brevis is described. The key steps involved in this synthesis are the Sharpless asymmetric epoxidation and regioselective ring opening of chiral epoxide by Gilman's reagent. The tetrahydropyran core has been constructed by an intramolecular S_N2 cyclisation.     

Box–Behnken Design-Based Development and Validation of a Reverse-Phase HPLC Analytical Method for the Estimation of Paclitaxel in Cationic Liposomes

Chromatographia - Stability-indicating reverse-phase HPLC analytical method for the quantification of Paclitaxel (PTX) in the bulk and cationic liposomes was developed. The optimized method was...