Anticoagulatory Substances of Bloodsucking Animals: From Hirudin to Hirudin Mimetics

Bloodsucking animals contain substances in their saliva that specifically interfere with the blood clotting system. These substances are mainly low molecular weight proteins with a molecular mass of between 4 and 50 kDa. Some have become accessible in large quantities with the help of genetic engineering, and as a result their structures and structure—activity relationships have been studied and clinically tested. In the light of what is known about the mode of action of these natural products at the molecular level, new compounds with possible therapeutic effect can be derived. In the last ten years this approach has been tested with the proteinase inhibitor hirudin, obtained from medicinal leeches, and with the thrombin/hirudin complex. The serine protease thrombin plays a central role in the complex pathway of the blood clotting process and its pathophysiological effect finally results in thrombosis. The selectivity of the formation of complexes from hirudin and thrombin lies in the bivalent interaction of the inhibitor with the active site of the enzyme as well as with a substrate recognition site outside of the active site, the so-called fibrin-(ogen) binding site (FBS). The knowledge of this mode of action enabled the synthesis of bifunctional thrombin inhibitors based on hirudin peptides. Hirudin and hirudin mimetics in vivo have been shown to be highly potent anticoagulants for the treatment of arterial and venous thrombosis.     

Screening the molecular surface of human anticoagulant protein C: A search for interaction sites

Protein C (PC), a 62 kDa multi-modular zymogen, is activated to an anticoagulant serine protease (activated PC or APC) by thrombin bound to thrombomodulin on the surface of endothelial cells. PC/APC interacts with many proteins and the characterisation of these interactions is not trivial. However, molecular modelling methods help to study these complex biological processes and provide basis for rational experimental design and interpretation of the results. PC/APC consists of a Gla domain followed by two EGF modules and a serine protease domain. In this report, we present two structural models for full-length APC and two equivalent models for full-length PC, based on the X-ray structures of Gla-domainless APC and of known serine protease zymogens. The overall elongated shape of the models is further cross-validated using size exclusion chromatography which allows evaluation of the Stokes radius (r_s for PC = 33.15 Å r_s for APC = 34.19 Å), frictional ratio and axial ratio. We then propose potential binding sites at the surface of PC/APC using surface hydrophobicity as a determinant of the preferred sites of intermolecular recognition. Most of the predicted binding sites are consistent with previously reported experimental data, while some clusters highlight new regions that should be involved in protein-protein interactions.     

Rolling‐Circle Amplification Detection of Thrombin Using Surface‐Enhanced Raman Spectroscopy with Core‐Shell Nanoparticle Probe

An ultrasensitive surface‐enhanced Raman spectroscopy (SERS) sensor based on rolling‐circle amplification (RCA)‐increased “hot‐spot” was developed for the detection of thrombin. The sensor contains a SERS gold nanoparticle@Raman label@SiO₂ core‐shell nanoparticle probe in which the Raman reporter molecules are sandwiched between a gold nanoparticle core and a thin silica shell by a layer‐by‐layer method. Thrombin aptamer sequences were immobilized onto the magnetic beads (MBs) through hybridization with their complementary strand. In the presence of thrombin, the aptamer sequence was released; this allowed the remaining single‐stranded DNA (ssDNA) to act as primer and initiate in situ RCA reaction to produce long ssDNAs. Then, a large number of SERS probes were attached on the long ssDNA templates, causing thousands of SERS probes to be involved in each biomolecular recognition event. This SERS method achieved the detection of thrombin in the range from 1.0×10^?12 to 1.0×10^?8 M and a detection limit of 4.2×10^?13 M , and showed good performance in real serum samples.     

Substrate Related O,O-Dialkyldipeptidylaminophosphonates,A New Type of Thrombin Inhibitor

Abstract

The facile reduction of O,O-dialkyl 1-hydroxyiminoalkanephosphonate precursors, using LiBH₄/Me₃SiCl in THF at ambient temperature, conveniently affords O,O-dialkyl 1-aminoalkanephosphonates in good yield and high state of purity. O,O-Dialkyl 1-aminobenzylphosphonates may be prepared in high yield and purity from catalytic hydrogenolysis of their 1-benzylaminobenzylphosphonate precursors. These biologically active aminophosphonates, when coupled to substrate derived dipeptides, produced a range of novel phosphonotripeptides based upon the ‘fibrinogen-like’ sequence H-D-Phe-Pro-Arg; where the phosphorus structural units replace the ‘Pl’Arg. These tripeptides showed a marked inhibitory specificity towards the trypsin-like serine protease thrombin, a ubiquitous enzyme that plays a crucial role in the cardiovascular system. The compounds possess an initial K_i in-vitro in the micromolar range against thrombin. Further enzyme kinetic analysis of the compound Z-D-Dpa-Pro-Pgl^P(OiPr)₂ (IC₅₀ 11.7 micromolar), showed that it displayed competitive inhibition characteristics toward thrombin, in contrast to the two stage slow-tight binding kinetics that had been shown by the analogous O,O-diphenyl derivative.     

OXIDATIVE DEPROTECTION OF TRIMETHYLSILYL ETHERS TO CARBONYL COMPOUNDS WITH PdCI2(PhCN)2-CrO3 AND CLAY-BIS(TRIMETHYLSILYL) CHROMATE IN SOLVENTLESS SYSTEM

Abstract

A simple and selective oxidative deprotection of trimethylsilyl ethers to carbony1 compounds is described that occurs on PdCl₂(PhCN)₂-CrO₃ and bis(trimethylsily1) chromate under solvent free conditions and is expedited by microwave irradiation.     

Behavior of serine proteases thrombin,trypsin, and chymotrypsin under conditions of MALDI-TOF-Mass spectrometry

Features of ion formation under the influence of laser emission under the conditions of MALDI-TOF mass spectrometry in the glycosylated protein thrombin and the related proteases trypsin and chymotrypsin were studied for the first time. It was shown that trypsin and chymotrypsin are ionized in the form of molecular ions with masses 23800 and 25660 Da respectively. The molecular ion of thrombin was not detected; three main fragment ions with masses 9951, 10230, and 11982 Da were detected in the mass spectrum of thrombin. It was suggested that these fragments relate to peptide and glycopeptides fragment ions formed as a result of bond cleavage in the region of Asn60G during exposure to laser emission under the conditions of MALDI-TOF mass spectrometry. __________ Translated from Teoreticheskaya i éksperimental’naya Khimiya, Vol. 44, No. 2, pp. 74–78, March–April, 2008.     

Protease‐Triggered,Integrin‐Targeted Cellular Uptake of Recombinant Protein Micelles

Targeting nanoparticles for drug delivery has great potential for improving efficacy and reducing side effects from systemic toxicity. New developments in the assembly of materials afford the opportunity to expose cryptic targeting domains in tissue‐specific microenvironments in which certain proteases are expressed. Here, recombinant proteins are designed to combine the responsiveness to environmental proteases with specific targeting. Materials made recombinantly allow complete control over amino acid sequence, in which each molecule is identically functionalized. Previously, oleosin, a naturally occurring plant protein that acts as a surfactant, has been engineered to self‐assemble into spherical micelles—a useful structure for drug delivery. To make oleosins that are locally activated to bind receptors, oleosin is genetically modified to incorporate the integrin‐binding motif RGDS just behind a domain cleavable by thrombin. The resulting modified oleosin self‐assembles into spherical micelles in aqueous environments, with the RGDS motif protected by the thrombin‐cleavable domain. Upon the addition of thrombin, the RGDS is exposed and the binding of the spherical micelles to breast cancer cells is increased fourfold.

     

Analysis of G‐quadruplex conformations using Raman and polarized Raman spectroscopy

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)₄‐3′, and a modified c‐Myc NHE‐III₁ sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na⁺ or K⁺, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm⁻¹ and 1420–1460 cm⁻¹ spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm⁻¹) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.