2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Synthesis of 2-(p-R-benzoylmethylene)-3-(p-R-phenyl)-1H-quinoxalines

The reaction of 1,2-diaminobenzenes with substituted 1,2-dibenzoyl-1,2-dibromoethanes constitutes a convenient synthetic route to the hitherto 2-(p-R-benzoylmethylene)-3-(p-R-phenyl)-1H-quinoxalines. Structures of all products were elucidated by ir, ¹H and ¹³C-nmr, mass spectra data. X-Ray crystallography data confirm assigned structures.     

Synthesis of novel tri-podal mesogenic alkenes and side-chain polysiloxanes

Low molecular weight tri-podal biphenyl- and benzoate-type mesogens [C₆H₅C₆H₄O(CH₂)₅SiMe₂CH₂CH₂SiMe₂]₃CH (4), [C₁₁H₂₃O(C₆H₄)₂O(CH₂)₅SiMe₂]₃CH (5) and [MeOC₆H₄OC(O)C₆H₄O(CH₂)₅SiMe₂]₃CH (6) (C₆H₄ = 1,4-phenylene) were obtained, from branched silyl substituted methane precursors [CH₂CH(Me)₂Si]₃CH (1) and (HMe₂Si)₃CH (2). The biphenyl-containing ones (4) and (5) were converted into terminal alkenes, which were subsequently hydrosilylated with poly(methylsiloxanes). The polymer derived from (5) exhibited mesomorphic properties. Such systems have the potential to significantly increase the density of liquid crystal rod-like structures in side chains of linear polymers (or dendritic liquid crystal polymers).     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Quantum mechanical valence study of a bond-breaking–bond-forming process in triatomic systems

The recently introduced set of the quadratic, two-electron covalent and ionic valence indices is used to investigate the bond-breaking–bond-forming (BB-BF ) process in an atom exchange reaction between H₂ and X (X = H, F—I) as well as in the O₂—H system. Valence changes accompanying selected charge reorganizations are examined within the three-orbital model and valence diagrams for symmetric transition states (TS s) are given. The UHF valence data for Li₂O and CO₂ and the H—H—X, O—O—H, and O—H—O (ABC) TS s (collinear and angular) are reported and compared to valence data in the separated fragments limits (SFL ), AB and BC. The overall valence, ν(ABC), and the total (ionic plus covalent) diatomic valences, ν_AB and ν_BC, are used as measures of the overall bond-order in a concerted BB–BF reaction, to test the postulate of the bond-energy–bond-order (BEBO ) model. In collinear TS s of H₂X, ν ? ?1, i.e., one bonding electron pari, is found to be roughly preserved, whereas in the angular H₂X and in collinear O—H—O TS s, the effect of increased valence at the saddle-point is observed, relative to that of diatomic fragments (reactiants or products). For the angular O—O—H TS , a similar increase in | ν (ABC)| relative to both O₂ and OH SFL s is detected; smaller changes relative to the O₂ data are found in the collinear TS . This observation is in agreement with earlier predictions from the intersecting-state model. The relative diatomic valences, ν/ν and ν/ν, are shown to conserve the overall relative bond multiplicity around 1 in both collinear and angular TS s of the H₂—X systems. © 1994 John Wiley & Sons, Inc.     

Synthesis and properties of 1-(6-methoxy)-2-benzothiazolyl)-2-pyridones

Substituted ]-(6-methoxy-2-benzothiazolyt)-2-pyridones were prepared from 2-amino-6-methoxybenzathiazate through N-(6-methoxy-2-benzothiazotyl) cyanvorearmileaznd-3-aryl-N-(6-methoxy-2-benzothiazolyt)-2-cyano-2-propenamides. The cyclization of the latter with malonodinitrile in the presence of piperidine gave the corresponding pyridones. The structures of the synthesized compounds were confirmed by¹H NMR and mass spectral data.Department of Organic Chemistry, Mass Spectrometry Laboratory, Slovak Technical University, 812 37 Bratislava, Slovakia. Published in Khimiya Geterotsiklicheskikh Soedinenii, No. 10, pp. 1402–1404, October, 1995. Original article submitted August 24, 1995.     

Carrier influence on the paramagnetic and catalytic properties of supported titanium complexes

Alumina-silica possessing various Al₂O₃/SiO₂ ratios was used as a carrier of surface titanium complexes. The systems obtained were examined as models for the investigation of the macroligand (inorganic gel) influence on the physicochemical properties of supported transition metal complexes. The titanium complexes were prepared first by the reaction of CpTiCl₃, with the hydroxyl groups of the gel and then reduced by an excess of BuLi. The influence was established of the basic gel properties on: (a) the amount of titanium(IV) and titanium(III) complexes on the alumina-silica gel surfaces; (b) the symmetry of the surface Ti^III surface complexes; (c) the electron density around the surface-Ti^III ions, ionic or covalent bonds character in a complex; and (d) the catalytic activity in olefin hydrogenation.     

Cis-coordination of the chromate anions in helical Co/Ni block-type polymeric systems. Structural and spectroscopic characteristics of catena(μ-CrO4-O,O′)[Co(HIm)3H2O] and catena(μ-CrO4-O,O′)[Co0.43Ni0.57(HIm)3H2O]

Two polymeric complexes: catena(μ-CrO₄-O,O′)[Co(HIm)₃H₂O] (1) and catena(μ-CrO₄-O,O′)[Co_0.43Ni_0.57(HIm)₃H₂O] (2) (where HIm=imidazole) with a cis-bridging coordination mode of the CrO₄ ²⁻ anion have been synthesized and characterized by X-ray and spectroscopic methods. These crystals were isolated from nine systems of varying reagent molar ratios and three excluding anions: Cl⁻, NO₃ ⁻ and SO₄ ²⁻ exclusively as mer [M(HIm)₃O₃]-type isomers. The unit cell of these isostructural complexes (monoclinic crystal system P2₁ /n) contains two independent helixes, left- and right handed, stabilized by intrahelical and interhelical hydrogen bonding and π–π interaction between pairs of the imidazole rings from neighbouring helixes. The Raman spectra at 77 K of 1 and 2 deconvoluted into lorentzian components revealed the block-type polymeric structure of the complexes. Moreover, the solution studies at millimolar concentrations of 1 and 2 indicated their complete decomposition in water. Four K electronic spectral analysis of the crystals (band deconvolution into gaussian components) enhanced with the data obtained in the polarized light allowed for assignment of the bands to the respective d–d transition (D_4h symmetry). It was found that the metallic centres are independently absorbing species, which supports the suggestion of a block-type structure of the polymers. The respective crystal field parameters for Co and Ni were calculated.     

Fluorescence lifetimes and spectral properties of protochlorophyllide in organic solvents in relation to the respective parameters in vivo

In this work, absorption and fluorescence spectra of protochlorophyllide (Pchlide), as well as its fluorescence lifetime, were investigated in organic solvents having different physical properties. The obtained Pchlide spectral features are discussed in relation to the parameters describing solvent properties (refractive index and dielectric constant) and taking into account the specific solvent-Pchlide interaction. The correlation of Pchlide Qy and Soret absorption bands with solvent polarizability function ((n2 - 1)/(n2 + 2)) has been found; however, the dispersion of the observed points was rather high. A small Stokes shift of a magnitude between 50 and 300 cm(-1) was found, which indicates low sensitivity of Pchlide to nonspecific solvation. The fluorescence decay of Pchlide was single exponential in all the investigated solvents, with the lifetime value ranging from 5.2 ns for dioxane to 3.5 ns for methanol. Dependence of the obtained fluorescence lifetimes on the solvent orientation polarizability, a parameter being the function of both refractive index and dielectric constant, was discussed. In water-methanol mixtures, a further decrease of the fluorescence lifetime was observed, giving values of 2.9 ns for 25% methanol. Double-exponential decay of Pchlide fluorescence was found for Pchlide in a solution of 15% methanol with the lifetimes of 4.5 +/- 0.5 ns and 1.2 +/- 0.3 ns and in pure water with the lifetimes of 2.5 +/- 0.5 ns and 0.4 +/- 0.1 ns. The obtained results are discussed in relation to spectroscopic properties of Pchlide in vivo.