Laser spectroscopic investigation of salicylic acids hydrogen bonded with water in supersonic jets: Microsolvation effects for excited state proton dislocation

Geometric structures and excited-state proton dislocation of size-selected salicylic acid clusters (salicylic acid and 5-methoxysalicylic acid) with water were studied by using laser spectroscopic techniques. Fluorescence excitation, dispersed fluorescence, and infrared (IR) spectra of those clusters in supersonic jets were examined for both the electronic ground (S0) and first excited (S1) states. The geometric structures of the clusters were determined on the basis of the IR spectra of the OH stretch region with the help of quantum chemical calculations. The hydroxyl group of the water moiety in the clusters forms a ring involving the carboxylic group of the salicylic acid moiety. The IR spectra in S0 show that the intramolecular hydrogen bond in the salicylic acid moiety is still held upon cluster formation, but the phenolic OH stretch band intensity is remarkably weaken in the clusters. The IR spectra in the S1 state and dispersed fluorescence spectra indicated that the intramolecular excited state proton dislocation is hardly affected by the microsolvation with water, in contrast with the strong suppression of the dislocation in the self-solvation.     

Dynamic nature of the intramolecular electronic coupling mediated by a solvent molecule: a computational study

We present a combined Molecular Dynamics/Quantum Chemical study of the solvent-mediated electronic coupling between an electron donor and acceptor in a C-clamp molecule. We characterize the coupling fluctuations due to the solvent motion for different solvents (acetonitrile, benzene, 1,3-diisopropyl-benzene) for the charge separation and the charge recombination processes. The time scale for solvent-induced coupling fluctuation is approximately 0.1 ps. The effect of these fluctuations on the observed rate is discussed using a recently developed theoretical model. We show that, while the microscopic charge transfer process is very complicated and its computational modeling very subtle, the macroscopic phenomenology can be captured by the standard models. Analyzing the contribution to the coupling given by different solvent orbitals, we find that many solvent orbitals mediate the electron transfer and that paths through different solvent orbitals can interfere constructively or destructively. A relatively small subset of substrate-solvent configurations dominate contributions to solvent-mediated coupling. This subset of configurations is related to the electronic structure of the C-clamp molecule.     

Reversible immobilization of engineered molecules by Ni-NTA chelators

Electrochemical synthesis of nickel-nitrilotriacetic acid (Ni-NTA) chelators, for subsequent immobilization of (His)(6)-tagged proteins (Photosystem II (PSII) as model molecule), on Au or Au-graphite electrodes is compared to chemical synthesis. Results show: (i) higher Ni-NTA surface density, (ii) shorter treatment time (1-12 min vs. 16 h normally needed for self-assembled monolayer (SAM)), (iii) possibility of addressing the chelator to only one Au electrode, in a sensor micro-array.     

Energetic and topological analysis of the reaction of Mo and Mo2 with NH3, C2H2, and C2H4 molecules

The Density functional theory has been applied to characterize the structural features of Mo(1,2)-NH(3),-C(2)H(4), and -C(2)H(2) compounds. Coordination modes, geometrical structures, and binding energies have been calculated for several spin multiplets. It has been shown that in contrast to the conserved spin cases (Mo(1,2)-NH(3)), the interaction between Mo (or Mo(2)) and C(2)H(4) (or C(2)H(2)) are the low-spin (Mo-C(2)H(4) and -C(2)H(2)) and high-spin (Mo(2)-C(2)H(4) and -C(2)H(2)) complexes. In the ground state of Mo(1,2)-C(2)H(4) and -C(2)H(2), the metal-center always reacts with the C-C center. The spontaneous formation of the global minima is found to be possible due to the crossing between the potential energy surfaces (ground and excited states with respect to the metallic center). The bonding characterization has been performed using the topological analysis of the Electron Localization Function. It has been shown that the most stable electronic structure for a pi-acceptor ligand correlates with a maximum charge transfer from the metal center to the C-C bond of the unsaturated hydrocarbons, resulting in the formation of two new basins located on the carbon atoms (away from hydrogen atoms) and the reduction of the number of attractors of the C-C basin. The interaction between Mo(1,2) and C(2)H(4) (or C(2)H(2)) should be considered as a chemical reaction, which causes the multiplicity change. Contrarily, there is no charge transfer between Mo(1,2) and NH(3), and the partners are bound by an electrostatic interaction.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Proton-coupled electron transfer in a model for tyrosine oxidation in photosystem II

Theoretical calculations of a model for tyrosine oxidation in photosystem II are presented. In this model system, an electron is transferred to ruthenium from tyrosine, which is concurrently deprotonated. This investigation is motivated by experimental measurements of the dependence of the rates on pH and temperature (Sj?din et al. J. Am. Chem. Soc. 2000, 122, 3932). The mechanism is proton-coupled electron transfer (PCET) at pH < 10 when the tyrosine is initially protonated and is single electron transfer (ET) for pH > 10 when the tyrosine is initially deprotonated. The PCET rate increases monotonically with pH, whereas the single ET rate is independent of pH and is 2 orders of magnitude faster than the PCET rate. The calculations reproduce these experimentally observed trends. The pH dependence for the PCET reaction arises from the decrease in the reaction free energies with pH. The calculations indicate that the larger rate for single ET arises from a combination of factors, including the smaller solvent reorganization energy for ET and the averaging of the coupling for PCET over the reactant and product hydrogen vibrational wave functions (i.e., a vibrational overlap factor in the PCET rate expression). The temperature dependence of the rates, the solvent reorganization energies, and the deuterium kinetic isotope effects determined from the calculations are also consistent with the experimental results.     

Inhibitory effects of 3-O-acyl-(+)-catechins on Epstein-Barr virus activation

In the course of an exploratory investigation of antitumor-promoting catechins, 3-O-acyl-(+)-catechins of varying carbon lengths from C(4) to C(18) were assessed for inhibitory effects on the activation of the Epstein-Barr virus early antigen. Like 3-O-acyl-(-)-epigallocatechins, the (+)-catechin derivatives showed promising effects with the C-3 acyl chain of C(8)-C(11) carbon atoms.     

TOF-SIMS and XPS-investigations of ion implanted single crystal 1b-diamonds

Near surface zones of (48)Ti- and (52)Cr-implanted single crystal diamonds (1b-MCD) were characterized by XPS, TOF-SIMS and white light interference microscopy (WLI). By the combination of WLI and TOF-SIMS it was possible to calibrate the depth scale of TOF-SIMS and XPS depth profiles quantitatively. The adjustment of TOF-SIMS and XPS elemental depth profiles in the implantation maximum increases the quantitative detection limit of the implanted elements by more than two orders of magnitude and enables the interpretation of results from wear simulation experiments. Peak fits of XPS C(1s)-photolines indicate the fraction and chemical nature of carbide-like structures in the implantation zone. Qualitative hints on carbide compounds are possibly included in the reconstructed TOF-SIMS spectra but this information can presently only be extracted with the aid of XPS analyses.     

Synthesis and aqueous solution properties of a well-defined thermo-responsive schizophrenic diblock copolymer

We report only the second example of a thermo-responsive 'schizophrenic' diblock copolymer surfactant: unlike the original (meth)acrylamide-based example reported by Laschewsky and co-workers (J. Am. Chem. Soc., 2002, 124, 3787), this new methacrylate-based diblock copolymer is near-monodisperse, readily synthesized in high yield and exhibits a broad temperature range between the two micelle transitions.     

On-membrane digestion of beta-casein for determination of phosphorylation sites by matrix-assisted laser desorption/ionization quadrupole/time-of-flight mass spectrometry

This article discusses the features of a newly developed matrix-assisted laser desorption/ionization quadrupole/time-of-flight (MALDI-QqTOF) mass spectrometer that is useful in the analysis of phosphorylated peptides. Aliquots of beta-casein, a commonly used phosphorylated protein standard, were digested with trypsin directly on a non-porous polyurethane membrane used as sample support in MALDI-QqTOF mass spectrometry (MS) experiments. Although a complete peptide map was obtained, it was difficult to obtain sequence information for some of the tryptic fragments, in particular T1-2, which bears four phosphate groups and is thus difficult to ionize in positive mode. This article focuses on the sequencing of this particular fragment by comparing MS/MS spectra obtained using different precursor ions. These precursors associated with T1-2 were [M + H](+), [M + H](2+), and [M + H - nH(3)PO(4)](+) ions. Typically, phosphorylated ions showed facile unimolecular losses of phosphoric acid moieties, and produced limited backbone fragmentation. The abundance of [M + H](2+) ions of T1-2 in the full mass spectrum was low relative to that of [M + H](+). [M + H - 4H(3)PO(4)](+) ions as MS/MS precursors underwent backbone fragmentations, with phosphoserine residues transformed into dehydroalanines or serines. Unusual b + 18 u fragments were observed, although only for segments with previously phosphorylated serines. These partly interfered with c-ions, and were noticeable due to overlapping isotopic envelopes. It was possible to establish the sequence of phosphorylated tryptic fragment T1-2 and the location of phosphate groups using the mass of dehydroalanine residues (69 Da) and b + 18 u fragments as markers. All MS and MS/MS spectra obtained with fully phosphorylated beta-casein were compared with spectra acquired with dephosphorylated beta-casein obtained commercially. These comparisons helped assess the spectral differences caused by the presence of phosphate groups. Also, they highlighted the potential usefulness of conducting dephosphorylation directly on the probe prior to MALDI analysis in future studies.