The effect of sample preparation on metal determination in soil by FAAS

Different methods for the determination of several metals in soils by flame atomic absorption spectrometry (FAAS) were investigated. Different procedures for total dissolution of soil: I – HF+HClO₄, H₃BO₃, HCl digestion (conventional heating), II – HF+HClO₄, H₃BO₃ digestion followed by fusion with LiBO₂ (conventional heating) and III – HF+HCl+HNO₃, H₃BO₃ digestion (microwave heating), as well as a leaching procedure with HNO₃+HClO₄, HCl were tested and compared. For quality assessment, the certified reference material S-1 soil was used. For most of the investigated metals, the best accuracy and precision were achieved when the procedure I or III were used. The developed procedure was applied to the analysis of soil samples from crude oil refinery and dump of petroleum origin wastes regions. Received: 22 Dezember 1997 / Revised: 9 February 1998 / Accepted: 12 February 1998     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Comparative DSC study of human and bovine serum albumin

The thermal denaturation process of bovine and human both fatty acid containing and fatty acid free albumins in aqueous solution was studied by use of differential scanning calorimetry. Human serum albumins were found to be more stable than their bovine counterparts. Fatty acid free albumins were characterized as generally less stable, more susceptible to aggregation, their unfolding endothermic transition was less cooperative and with the smaller degree of reversibility. Deconvolution analysis with using a non-two-state model with two component transitions showed essential differences in the thermodynamic parameters between all studied albumins, particularly regarding the high-temperature component transition.     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

Novel Host Compounds, 1,1′-Binaphthyl-2,2′-Dihydroxy-5,5′- and 6,6′-Dicarboxylic Acid, which Trap Guest Molecules Tightly in their Inclusion Crystals

The host compounds 1,1’-binaphthyl-2,2′-dihydroxy-5,5′-dicarboxylic acid (1) and 1,1′-binaphthyl-2,2′-dihydroxy-6,6′-dicarboxylic acid (2) have been synthesized, and their inclusion properties have been studied. Inclusion complexes formed by 1 and 2 with volatile guests such as acetone and methanol release the guests only at much higher temperatures than their boiling points. The crystal structures of the inclusion complexes have been determined from single crystal X-ray diffraction data and show different host lattices.     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Synthesis and properties of 1-(6-methoxy)-2-benzothiazolyl)-2-pyridones

Substituted ]-(6-methoxy-2-benzothiazolyt)-2-pyridones were prepared from 2-amino-6-methoxybenzathiazate through N-(6-methoxy-2-benzothiazotyl) cyanvorearmileaznd-3-aryl-N-(6-methoxy-2-benzothiazolyt)-2-cyano-2-propenamides. The cyclization of the latter with malonodinitrile in the presence of piperidine gave the corresponding pyridones. The structures of the synthesized compounds were confirmed by¹H NMR and mass spectral data.Department of Organic Chemistry, Mass Spectrometry Laboratory, Slovak Technical University, 812 37 Bratislava, Slovakia. Published in Khimiya Geterotsiklicheskikh Soedinenii, No. 10, pp. 1402–1404, October, 1995. Original article submitted August 24, 1995.     

Carrier influence on the paramagnetic and catalytic properties of supported titanium complexes

Alumina-silica possessing various Al₂O₃/SiO₂ ratios was used as a carrier of surface titanium complexes. The systems obtained were examined as models for the investigation of the macroligand (inorganic gel) influence on the physicochemical properties of supported transition metal complexes. The titanium complexes were prepared first by the reaction of CpTiCl₃, with the hydroxyl groups of the gel and then reduced by an excess of BuLi. The influence was established of the basic gel properties on: (a) the amount of titanium(IV) and titanium(III) complexes on the alumina-silica gel surfaces; (b) the symmetry of the surface Ti^III surface complexes; (c) the electron density around the surface-Ti^III ions, ionic or covalent bonds character in a complex; and (d) the catalytic activity in olefin hydrogenation.     

Cis-coordination of the chromate anions in helical Co/Ni block-type polymeric systems. Structural and spectroscopic characteristics of catena(μ-CrO4-O,O′)[Co(HIm)3H2O] and catena(μ-CrO4-O,O′)[Co0.43Ni0.57(HIm)3H2O]

Two polymeric complexes: catena(μ-CrO₄-O,O′)[Co(HIm)₃H₂O] (1) and catena(μ-CrO₄-O,O′)[Co_0.43Ni_0.57(HIm)₃H₂O] (2) (where HIm=imidazole) with a cis-bridging coordination mode of the CrO₄ ²⁻ anion have been synthesized and characterized by X-ray and spectroscopic methods. These crystals were isolated from nine systems of varying reagent molar ratios and three excluding anions: Cl⁻, NO₃ ⁻ and SO₄ ²⁻ exclusively as mer [M(HIm)₃O₃]-type isomers. The unit cell of these isostructural complexes (monoclinic crystal system P2₁ /n) contains two independent helixes, left- and right handed, stabilized by intrahelical and interhelical hydrogen bonding and π–π interaction between pairs of the imidazole rings from neighbouring helixes. The Raman spectra at 77 K of 1 and 2 deconvoluted into lorentzian components revealed the block-type polymeric structure of the complexes. Moreover, the solution studies at millimolar concentrations of 1 and 2 indicated their complete decomposition in water. Four K electronic spectral analysis of the crystals (band deconvolution into gaussian components) enhanced with the data obtained in the polarized light allowed for assignment of the bands to the respective d–d transition (D_4h symmetry). It was found that the metallic centres are independently absorbing species, which supports the suggestion of a block-type structure of the polymers. The respective crystal field parameters for Co and Ni were calculated.