Enzymatic synthesis of 3-hydroxybutyramides and their conversion to optically active 1,3-aminoalcohols

3-Hydroxybutyramides are obtained in high optical yield from ethyl (±)-3-hydroxybutyrate and aliphatic amines when the reaction is catalyzed by Candida antartica lipase. The chemical reduction of these 3-hydroxybutyramides yields the corresponding 1,3 -aminoalcohols.     

A parametric study of surface-discharge nitrogen lasers

A parametric study of sandwich-type discharge chamber nitrogen lasers has been carried out. A non-monotonic dependence of the energy emitted by the laser and the discharge chamber thickness is found. Discharge chambers with = 1 have the best electro-optical efficiency. The ratio between the electrode gap,d, and is found to be a scaling parameter. The possible influence of wall ablation in the comportment is also discussed.     

The ionization constants of alpha-alanine in NaCl at 25 degrees. Effect of the ionic strength based on three models

In the present work we obtained the experimental pKs of the amino acid alpha-alanine in NaCl at 25 degrees and different ionic strengths. The equilibrium constants have been potentiometrically determined with a commercial glass electrode and the results analysed through three models: two directly based on the Pitzer and Scatchard approaches to the ion specific interaction theory and the other based on a simpler modification of the Debye-Hückel equation. The three models fit the data reasonably well and the extrapolated pK values obtained show a good agreement. The goodness of the ridge regression method cannot be probed in this case.     

Comparison of chemical properties of food products processed by conventional and ohmic heating

The effect of ohmic and conventional heat processing of different food products on their chemical and physical parameters was studied. Depending on the food being analysed, parameters such as pH, total solids, ash, titratable acidity, ascorbic acid, total sugars, total fatty acids, total phenolic compounds, and anthocyanins content were determined before and after ohmic and conventional pasteurization techniques and the results were compared using one-way analysis of variance. In goat milk samples treated by ohmic technology the pH value (6.58) and total fatty acids content in milk fat (86.5 mass %) were comparable to those found in milk treated by conventional process, however, ohmically treated samples presented a lower content of lactic acid, 0.13 %. In cloudberry jam samples treated by ohmic technology the results of some of the main parameters tested, such as total sugar content 46.1 mass %, ascorbic acid content 2.83 mass %, and titratable acidity 6.01 mass % (as citric acid) did not show significant differences when compared with samples treated by conventional technology. Presented at the 33rd International Conference of the Slovak Society of Chemical Engineering, Tatranské Matliare, 22–26 May 2006.     

Single-step preparation and catalytic activity of mesoporous MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups analogous to Nafion

Preparation of hybrid organic-inorganic MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups has been achieved in a single step by reacting the mesoporous silicas with 1,2,2-trifluoro-2-hydroxy-1-trifluoromethylethane sulfonic acid beta-sultone; the catalysts showed higher activity than commercial Nafion-silica composite for the esterification of long chain fatty acids with ethanol.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Multiresidue determination of fluoroquinolones in shrimp by liquid chromatography-fluorescence-mass spectrometry

An efficient multiresidue method for analysis of fluoroquinolones in shrimp has been developed in which quantitation by fluorescence and confirmation by Multiple Stage Mass Spectrometry (MS) is achieved simultaneously. In this method, shrimp tissue is extracted with ammoniacal acetonitrile and the extract is defatted and then evaporated. After dissolution in basic phosphate buffer, fluoroquinolones in the extract are separated by liquid chromatography and quantitated, taking advantage of their intense fluorescence. Eluate from the fluorescence detector enters the MS, which allows for confirmation by monitoring ratios of 2 prominent product ions in the MS3 or MS2 spectrum. Using this method, 8 fluoroquinolones have been analyzed in shrimp samples fortified at 10, 25, 50, or 100 ppb levels. Recoveries for desethyleneciprofloxacin, norfloxacin, ciprofloxacin, danofloxacin, enrofloxacin, orbifloxacin, sarafloxacin, and difloxacin ranged from 75 to 92%, with relative standard deviation values of <6%. The limits of quantitation ranged from 0.1 to 1 ng/g. Enrofloxacin and ciprofloxacin were also successfully determined in enrofloxacin-incurred shrimp using this method.     

Effect of ionic strength on the formal potential of the glass electrode in various saline media

We examined the variation with ionic strength (I, adjusted with KCl, KNO₃, KBr, NaCl or NaClO₄) of the formal potential (E_const) for glass electrodes exhibiting a Nernstian response (i.e. E_cell=E_const−s log [H⁺]). For this purpose, we investigated the different factors included in the formal potential, so we obtained reported values for the liquid junction potential as a function of ionic strength and determined the logarithm of the activity coefficient for the proton in various saline media, using Pitzer equations.     

Highly enantioselective synthesis of 2H-1-benzothiopyrans by a catalytic domino reaction

A highly enantioselective catalytic asymmetric synthesis of 2H-1-benzothiopyrans is presented. The organocatalytic asymmetric domino reactions between 2-mercaptobenzaldehyde and α,β-unsaturated aldehydes proceed with excellent chemo- and enantioselectivities to give the corresponding pharmaceutically valuable benzothiopyrans in high yields with 91-98% ee.