A tris(2,2'-bipyridine)ruthenium(II) derivative tethered to a cis-PtCl2(amine)2 moiety: syntheses, spectroscopic properties, and visible-light-induced scission of DNA

A tris(2,2'-bipyridine)ruthenium(II) derivative having two N-(3-ammoniopropyl)carbamoyl pendant units has been prepared and reacted with cis-PtCl2(DMSO)2 (DMSO = dimethyl sulfoxide) to give a heteronuclear Ru(II)Pt(II) dimer having a cis-Pt(II)Cl2(aliphatic amine)2 unit, [Ru(bpy)2(mu-bridge)PtCl2](PF6)2 (bpy = 2,2'-bipyridine, bridge = 4,4'-bis(N-(3-aminopropyl)carbamoyl)-2,2'-bipyridine). The ESI-TOF mass spectrum of the Ru(II)Pt(II) dimer shows a set of signals corresponding to {[Ru(bpy)2(mu-bridge)PtCl2](PF6)}(+) (m/z 1181.1). The MLCT (metal-to-ligand charge transfer) luminescence intensity is enhanced upon the platination of two amine units, presumably due to the formation of a relatively rigid metallocycle. More interestingly, the luminescence intensity is further enhanced by the complexation of the Ru(II)Pt(II) dimer with either 5'-GMP (guanosine 5'-monophosphate disodium salt) or calf thymus DNA. Visible-light-induced scission of supercoiled pBR322 DNA is found to be efficiently enhanced in the presence of the title Ru(II)Pt(II) dimer.     

Electrochemical and luminescent properties of new mononuclear ruthenium(II) and binuclear iridium(III)-ruthenium(II) terpyridine complexes.

Hexafluorophosphate salts of mononuclear complexes [Ru(II)Cl(L)(terpy)]+ (L = dmbpy (1); dpbpy (2), sambpy (3), and dpp (7), and binuclear complexes [Ru(II)2Cl2(dpp)(terpy)2]2+ (8) and [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+ (9) were prepared and characterized. Abbreviations of the ligands are bpy = 2,2'-bipyridine, dmbpy = 4,4'-dimethyl-2,2'-bipyridine, dpbpy = 4,4'-diphenyl-2,2'-bipyridine, dpp = 2,3-bis(2-pyridyl)pyrazine, sambpy = 4,4'-bis((S)-(+)-alpha-1-phenylethylamido)-2,2'-bipyridine, and terpy = 2,2':6',2'-terpyridine. The absorption spectra of 8 and 9 are dominated by ligand-centered bands in the UV region and by metal-to-ligand charge-transfer bands in the visible region. The details of their spectroscopic and electrochemical properties were investigated. In both binuclear complexes, it has been found that the HOMO is based on the Ru metal, and LUMO is dpp-based. [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+, indicating intense emission at room temperature, and a lifetime of 154 ns. The long lifetime of this bimetallic chromophore makes it a useful component in the design of supramolecular complexes.     

Tuning of luminescence spectra of neutral ruthenium(II) complexes by crystal waters

Neutral ruthenium(II) complexes [RuLL'(CN)2] (L, L' = bpy, dmb, dbb; bpy = 2,2'-bipyridine, dmb = 4,4'-dimethyl-2,2'-bipyridine, dbb = 4,4'-tert-butyl-2,2'-bipyridine) were prepared, and the luminescence characteristics of the complexes in the solid state were measured. The luminescence was tuned by crystal waters included in the crystals; for example, [Ru(dbb)2(CN)2] x 2H2O, [Ru(dbb)2(CN)2] x H2O, and [Ru(dbb)2(CN)2] emit luminescence at 640, 685, and 740 nm, respectively.     

Hydride ion transfer from ruthenium(II) complexes in water: kinetics and mechanism

Reactions of hydride complexes of ruthenium(II) with hydride acceptors have been examined for Ru(terpy)(bpy)H(+), Ru(terpy)(dmb)H(+), and Ru(η(6)-C(6)Me(6))(bpy)(H)(+) in aqueous media at 25 °C (terpy = 2,2';6',2'-terpyridine, bpy = 2,2'-bipyridine, dmb = 4,4'-dimethyl-2,2'-bipyridine). The acceptors include CO(2), CO, CH(2)O, and H(3)O(+). CO reacts with Ru(terpy)(dmb)H(+) with a rate constant of 1.2 (0.2) × 10(1) M(-1) s(-1), but for Ru(η(6)-C(6)Me(6))(bpy)(H)(+), the reaction was very slow, k ≤ 0.1 M(-1) s(-1). Ru(terpy)(bpy)H(+) and Ru(η(6)-C(6)Me(6))(bpy)(H)(+) react with CH(2)O with rate constants of (6 ± 4) × 10(6) and 1.1 × 10(3) M(-1) s(-1), respectively. The reaction of Ru(η(6)-C(6)Me(6))(bpy)(H)(+) with acid exhibits straightforward, second-order kinetics, with the rate proportional to [Ru(η(6)-C(6)Me(6))(bpy)(H)(+)] and [H(3)O(+)] and k = 2.2 × 10(1) M(-1) s(-1) (μ = 0.1 M, Na(2)SO(4) medium). However, for the case of Ru(terpy)(bpy)H(+), the protonation step is very rapid, and only the formation of the product Ru(terpy)(bpy)(H(2)O)(2+) (presumably via a dihydrogen or dihydride complex) is observed with a k(obs) of ca. 4 s(-1). The hydricities of HCO(2)(-), HCO(-), and H(3)CO(-) in water are estimated as +1.48, -0.76, and +1.57 eV/molecule (+34, -17.5, +36 kcal/mol), respectively. Theoretical studies of the reactions with CO(2) reveal a "product-like" transition state with short C-H and long M-H distances. (Reactant) Ru-H stretched 0.68 ?; (product) C-H stretched only 0.04 ?. The role of water solvent was explored by including one, two, or three water molecules in the calculation.     

Orientation tuning of a polypyridyl Ru(II) complex immobilized on a clay surface toward chiral discrimination

The present work reports an attempt to elucidate a stereoselective energy-transfer system by immobilizing a chiral metal complex on a clay surface. The metal complex used was [Ru(bpy)2L(i)]2+ with L1 = bpy (2,2'-bipyridine), L2 = 4,4'-diundecyl-2,2'-bipyridine, and L3 = 5,5'-diundecyl-2,2'-bipyridine. The adsorption structure of [Ru(bpy)2L(i)]2+ was studied by means of electric dichroism measurements on an aqueous dispersion of a colloidal clay. It was found that the molecular orientation of the adsorbed Ru(II) complex was affected remarkably by the positions of the alkyl chains on the bpy ligand; that is, the angle of the 3-fold or pseudo-3-fold symmetry axis of the Ru(II) complex with respect to the surface normal was obtained to be 24 degrees, 30 degrees, and 52 degrees for i = 1, 2, and 3, respectively. The efficiency of the energy-transfer was determined by photoluminescence quenching measurements between the adsorbed Ru(II) complex and [Ru(acac)3] (acac = acetylacetonate) in solution. As a result, stereoselectivity appeared most for the case of [Ru(bpy)2L3]2+ in which its two helically twisted bpy ligands were projected in an outward direction.     

Synthesis of heteroleptic bis(diimine)carbonylchlororuthenium(II) complexes from photodecarbonylated precursors

The reactions of bidentate diimine ligands (L2) with binuclear [Ru(L1)(CO)Cl2]2 complexes [L1 not equal to L2 = 2,2'-bipyridine (bpy), 4,4'-dimethyl-2,2'-bipyridine (4,4'-Me2bpy), 5,5'-dimethyl-2,2'-bipyridine (5,5'-Me2bpy), 1,10-phenanthroline (phen), 4,7-dimethyl-1,10-phenanthroline (4,7-Me2phen), 5,6-dimethyl-1,10-phenanthroline (5,6-Me2phen), di(2-pyridyl)ketone (dpk), di(2-pyridyl)amine (dpa)] result in cleavage of the dichloride bridge and the formation of cationic [Ru(L1)(L2)(CO)Cl]+ complexes. In addition to spectroscopic characterization, the structures of the [Ru(bpy)(phen)(CO)Cl]+, [Ru(4,4'-Me2bpy)(5,6-Me2phen)(CO)Cl]+ (as two polymorphs), [Ru(4,4'-Me2bpy)(4,7-Me2phen)(CO)Cl]+, [Ru(bpy)(dpa)(CO)Cl]+, [Ru(5,5'-Me2bpy)(dpa)(CO)Cl]+, [Ru(bpy)(dpk)(CO)Cl]+, and [Ru(4,4'-Me2bpy)(dpk)(CO)Cl]+ cations were confirmed by single crystal X-ray diffraction studies. In each case, the structurally characterized complex had the carbonyl ligand trans to a nitrogen from the incoming diimine ligand, these complexes corresponding to the main isomers isolated from the reaction mixtures. The synthesis of [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)(NO3)]+ from [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)Cl]+ and AgNO3 demonstrates that exchange of the chloro ligand can be achieved.     

Near-infrared absorbing and emitting Ru(II)-Pt(II) heterodimetallic complexes of dpdpz (dpdpz = 2,3-di(2-pyridyl)-5,6-diphenylpyrazine)

The reaction of 2,3-di(2-pyridyl)-5,6-diphenylpyrazine (dpdpz) with K(2)PtCl(4) in a mixture of acetonitrile and water afforded mono-Pt complex (dpdpz)PtCl(2)4 in good yield, with two lateral pyridine nitrogen atoms binding to the metal center. Two types of Ru(II)-Pt(II) heterodimetallic complexes bridged by dpdpz, namely, [(bpy)(2)Ru(dpdpz)Pt(C≡CC(6)H(4)R)](2+) (7-9, R = H, NMe(2), or Cl, respectively) and [(tpy)Ru(dpdpz)Pt(C≡CPh)] (+) (12), were then designed and prepared, where bpy = 2,2'-bipyridine and tpy = 2,2';6',2'-terpyridine. In both cases, the platinum atom binds to dpdpz with a C(∧)N(∧)N tridentate mode. However, the coordination of the ruthenium atom with dpdpz could either be noncyclometalated (N(∧)N bidentate) or cyclometalated (C(∧)N(∧)N tridentate). The electronic properties of these complexes were subsequently studied and compared by spectroscopic and electrochemical analyses and theoretical calculations. These complexes exhibit substantial absorption in the visible to NIR (near-infrared) region because of mixed MLCT (metal-to-ligand-charge-tranfer) transitions from both the ruthenium and the platinum centers. Complexes 7 and 9 were found to emit NIR light with higher quantum yields than those of the mono-Ru complex [(bpy)(2)Ru(dpdpz)](2+) (5) and bis-Ru complex [(bpy)(2)Ru(dpdpz)Ru(bpy)(2)](4+) (13). However, no emission was detected from complex 8 or 12 at room temperature in acetonitrile.     

Mechanistic investigation of CO2 hydrogenation by Ru(II) and Ir(III) aqua complexes under acidic conditions: two catalytic systems differing in the nature of the rate determining step

Ruthenium aqua complexes [(eta(6)-C(6)Me(6))Ru(II)(L)(OH(2))](2+) {L = bpy (1) and 4,4'-OMe-bpy (2), bpy = 2,2'-bipyridine, 4,4'-OMe-bpy = 4,4'-dimethoxy-2,2'-bipyridine} and iridium aqua complexes [Cp*Ir(III)(L)(OH(2))](2+) {Cp* = eta(5)-C(5)Me(5), L = bpy (5) and 4,4'-OMe-bpy (6)} act as catalysts for hydrogenation of CO(2) into HCOOH at pH 3.0 in H(2)O. The active hydride catalysts cannot be observed in the hydrogenation of CO(2) with the ruthenium complexes, whereas the active hydride catalysts, [Cp*Ir(III)(L)(H)](+) {L = bpy (7) and 4,4'-OMe-bpy (8)}, have successfully been isolated after the hydrogenation of CO(2) with the iridium complexes. The key to the success of the isolation of the active hydride catalysts is the change in the rate-determining step in the catalytic hydrogenation of CO(2) from the formation of the active hydride catalysts, [(eta(6)-C(6)Me(6))Ru(II)(L)(H)](+), to the reactions of [Cp*Ir(III)(L)(H)](+) with CO(2), as indicated by the kinetic studies.     

Mono- and dinuclear ruthenium(II) 1,6,7,12-tetraazaperylene complexes

We report the synthesis of free 1,6,7,12-tetraazaperylene (tape). Tape was obtained from 1,1'-bis-2,7-naphthyridine by potassium promoted cyclization followed by oxidation with air. Mono- and dinuclear ruthenium(II) 1,6,7,12-tetraazaperylene complexes of the general formulas [Ru(L-L)(2)(tape)](PF(6))(2), [1](PF(6))(2)-[5](PF(6))(2), and [{Ru(L-L)(2)}(2)(μ-tape)](PF(6))(4), [6](PF(6))(4)-[10](PF(6))(4), with{L-L = phen, bpy, dmbpy (4,4'-dimethyl-2,2'-bipyridine), dtbbpy (4,4'-ditertbutyl-2,2'-bipyridine) and tmbpy (4,4'5,5'-tetramethyl-2,2'-bipyridine)}, respectively, were synthesized. The X-ray structures of tape·2CHCl(3) and the mononuclear complexes [Ru(bpy)(2)(tape)](PF(6))(2)·0.5CH(3)CN·0.5toluene, [Ru(dmbpy)(2)(tape)](PF(6))(2)·2toluene and [Ru(dtbbpy)(2)(tape)](PF(6))(2)·3acetone·0.5H(2)O were solved. The UV-vis absorption spectra and the electrochemical behavior of the ruthenium(ii) tape complexes were explored and compared with the data of the analogous dibenzoeilatin (dbneil), 2,2'-bipyrimidine (bpym) and tetrapyrido[3,2-a:2',3'-c:3',2'-h:2',3'-j]phenazin (tpphz) species.     

Light-induced charge separation and photocatalytic hydrogen evolution from water using Ru(II)Pt(II)-based molecular devices: effects of introducing additional donor and/or acceptor sites

In our hopes to improve the photocatalytic efficiency of photo-hydrogen-evolving molecular devices, several new dyads and triads possessing a photosensitizing Ru(bpy)(phen)(2)(2+) (or Ru(phen)(3)(2+)) chromophore (abbreviated as Ru(II)) attached to both/either a phenothiazine moiety (abbreviated as Phz) and/or H(2)-evolving PtCl(2)(bpy) units (abbreviated as Pt), such as Phz-Ru(II)-Pt2 (triad), Ru(II)-Pt2 (dyad), and Ru(II)-Pt3 (dyad), were synthesized and their basic properties together with the photo-hydrogen-evolving characteristics were investigated in detail. The (3)MLCT phosphorescence from the Ru(II) moiety in these systems is substantially quenched due to the highly efficient photoinduced electron transfer (PET). Based on the electrochemical studies, the driving forces for the PET were estimated as -0.07 eV for Phz-Ru(II)-Pt2, -0.24 eV for Ru(II)-Pt2, and -0.22 eV for Ru(II)-Pt3, revealing the exergonic character of the PET in these systems. Luminescence lifetime studies revealed the existence of more than two decay components, indicative of a contribution of multiple PET processes arising from the presence of at least two different conformers in solution. The major luminescence decay components of the hybrid systems [τ(1) = 6.5 ns (Ru(II)-Pt2) and τ(1) = 1.04 ns (Phz-Ru(II)-Pt2) in acetonitrile] are much shorter than those of Phz-free/Pt-free Ru(bpy)(phen)(2)(2+) derivatives. An important finding is that the triad Phz-Ru(II)-Pt2 affords a quite long-lived charge separated (CS) state (τ(CS) = 43 ns), denoted as Phz(+)˙-Ru(Red)-Pt2, as a result of reductive quenching of the triplet excited state of Ru(bpy)(phen)(2)(2+) by the tethering Phz moiety, where Ru(Red) denotes Ru(bpy)(phen)(2)(+). Moreover, the lifetime of Phz(+)˙-Ru(Red)-Pt2 was observed to be much longer than that of Phz(+)˙-Ru(Red). The photocatalytic H(2) evolution from water driven by these systems was examined in an aqueous acetate buffer solution (pH 5.0) containing 4-19% dimethylsulfoxide (solubilising reagent) in the presence of EDTA as a sacrificial electron donor. Dyads Ru(II)-Pt2 and Ru(II)-Pt3 were found to exhibit improved photo-hydrogen-evolving activity compared to the heterodinuclear Ru-Pt dyads developed so far in our group. On the other hand, almost no catalytic activity was observed for Phz-Ru(II)-Pt2 in spite of the formation of a strongly reducing Ru(Red) site (Phz(+)˙-Ru(Red)-Pt2), indicating that the electron transfer from the photogenerated Ru(Red) unit to the PtCl(2)(bpy) unit is not favoured presumably due to the slow electron transfer rate in the Marcus inverted region.     

Effects of electron withdrawing and donating groups on the efficiency of tris(2,2'-bipyridyl)ruthenium(II)/tri-n-propylamine electrochemiluminescence

The effects of electron withdrawing and electron donating groups on the electrochemiluminescent (ECL) properties of tris(2,2'-bipyridyl)ruthenium(II) (Ru(bpy)3(2+) where bpy = 2,2'-pyridine) are reported. The electrochemistry, photophysics and ECL of (bpy)2Ru(DC-bpy)2+, and (bpy)2Ru(DM-bpy)2+ (DC = 4,4'-dicarboxy-2,2'-bipyridine; DM = 4,4'-dimethyl-2,2'-bipyridine) have been studied relative to Ru(bpy)3(2+) in 50:50 (v/v) acetonitrile(CH3CN):H2O (0.1 M KH2PO4), and aqueous solutions. Furthermore, the effects of Triton X-100 (polyethylene glycol tert-octylphenyl ether) on the electrochemical, spectroscopic and ECL properties of these compounds are reported. The anodic oxidation of Ru(bpy)3(2+), (bpy)2Ru(DC-bpy)2+, and (bpy)2Ru(DM-bpy)2+ produces ECL in the presence of tri-n-propylamine (TPrA) in all solvent systems. ECL efficiencies (phi(ecl), photons produced per redox event) of 0.73 and 0.84 for (bpy)2Ru(DC-bpy)2+, and (bpy)2Ru(DM-bpy)2+ were obtained in aqueous buffered solution, using Ru(bpy)3(2+) as a relative standard (phi(ecl) = 1.0). Addition of 0.4 mM Triton X-100 results in a greater than 2-fold increase in ECL efficiences (i.e., 3.8, 2.4 and 2.3 for Ru(bpy)3(2+), (bpy)2Ru(DC-bpy)2+, and (bpy)2Ru(DM-bpy)2+, respectively) using aqueous Ru(bpy)3(2+) containing no surfactant as standard (phi(ecl) = 1.0). ECL efficiencies of 27.4, 16.5 and 26.1 were found in 50:50 (v/v) CH3CN:H2O (0.1 M KH2PO4) for Ru(bpy)3(2+), (bpy)2Ru(DC-bpy)2+, and (bpy)2Ru(DM-bpy)2+, respectively, using aqueous Ru(bpy)3(2+) containing no surfactant as standard (phi(ecl) = 1.0). Detailed studies support adsorption of surfactant on the electrode surface, thus facilitating TPrA and ruthenium oxidation.     

Palladium(II) and platinum(II) organometallic complexes with the model nucleobase anions of thymine, uracil, and cytosine: antitumor activity and interactions with DNA of the platinum compounds

Pd(II) and Pt(II) complexes with the anions of the model nucleobases 1-methylthymine (1-MethyH), 1-methyluracil (1-MeuraH), and 1-methylcytosine (1-MecytH) of the types [Pd(dmba)(mu-L)]2 [dmba = N,C-chelating 2-((dimethylamino)methyl)phenyl; L = 1-Methy, 1-Meura or 1-Mecyt] and [M(dmba)(L)(L')] [L = 1-Methy or 1-Meura; L' = PPh(3) (M = Pd or Pt), DMSO (M = Pt)] have been obtained. Palladium complexes of the types [Pd(C6F5)(N-N)(L)] [L = 1-Methy or 1-Meura; N-N = N,N,N',N'-tetramethylethylenediamine (tmeda), 2,2'-bipyridine (bpy), or 4,4'-dimethyl-2,2'-bipyridine (Me2bpy)] and [NBu4][Pd(C6F5)(1-Methy)2(H2O)] have also been prepared. The crystal structures of [Pd(dmba)(mu-1-Methy)]2, [Pd(dmba)(mu-1-Mecyt)]2.2CHCl3, [Pd(dmba)(1-Methy)(PPh3)].3CHCl3, [Pt(dmba)(1-Methy)(PPh3)], [Pd(tmeda)(C6F5)(1-Methy)], and [NBu4][Pd(C6F5)(1-Methy)2(H2O)].H2O have been established by X-ray diffraction. The DNA adduct formation of the new platinum complexes synthesized was followed by circular dichroism and electrophoretic mobility. Atomic force microscopy images of the modifications caused by the platinum complexes on plasmid DNA pBR322 were also obtained. Values of IC50 were also calculated for the new platinum complexes against the tumor cell line HL-60. All the new platinum complexes were more active than cisplatin (up to 20-fold in some cases).     

Synthesis and structural,electrochemical, and optical properties of Ru(II) complexes with azobis(2,2'-bipyridine)s

Two new ditopic ligands, 5,5"-azobis(2,2'-bipyridine) (5,5"-azo) and 5,5"-azoxybis(2,2'-bipyridine) (5,5"-azoxy), were prepared by the reduction of nitro precursors. Mononuclear and dinuclear Ru(II) complexes having one of these bridging ligands and 2,2'-bipyridine terminal ligands were also prepared, and their properties were compared with previously reported Ru(II) complexes having 4,4"-azobis(2,2'-bipyridine) (4,4"-azo). The X-ray crystal structure showed that 5,5"-azo adopts the trans conformation and a planar rodlike shape. The X-ray crystal structure of [(bpy)(2)Ru(5,5"-azo)Ru(bpy)(2)](PF(6))(4) (Ru(5,5"-azo)Ru) showed that the bridging ligand is in the trans conformation and nearly planar also in the complex and the metal-to-metal distance is 10.0 A. The azo or azoxy ligand in these complexes exhibits reduction processes at less negative potentials than the terminal bpy's due to the low-lying pi level. The electronic absorption spectra for the complexes having 5,5"-azo or 5,5"-azoxy exhibit an extended low-energy metal-to-ligand charge-transfer absorption. The ligands, 5,5"-azo and 5,5"-azoxy, and the mononuclear complex, [(bpy)(2)Ru(5,5"-azo)](2+), isomerize reversibly upon light irradiation. The low-energy MLCT state sensitizes the isomerization of the azo moiety in this complex. While [(bpy)(2)Ru(4,4"-azo)Ru(bpy)(2)](PF(6))(4) exhibits light switch properties, namely, significant electrochromism and a large luminescence enhancement, upon reduction, Ru(5,5"-azo)Ru does not show these properties. The radical anion formation upon reduction of these complexes has been confirmed by ESR spectroscopy.     

Syntheses, characterization, and photochemical properties of amidate-bridged Pt(bpy) dimers tethered to Ru(bpy)3(2+) derivatives

Amidate-bridged diplatinum(II) entities [Pt(2)(bpy)(2)(μ-amidato)(2)](2+) (amidate = pivalamidate and/or benzamidate; bpy = 2,2'-bipyridine) were covalently linked to one or two Ru(bpy)(3)(2+)-type derivatives. An amide group was introduced at the periphery of Ru(bpy)(3)(2+) derivatives to give metalloamide precursors [Ru(bpy)(2)(BnH)](2+) (abbreviated as RuBnH, n = 1 and 2), where deprotonation of amide BnH affords the corresponding amidate Bn, B1H = 4-(4-carbamoylphenyl)-2,2'-bipyridine, and B2H = ethyl 4'-[N-(4-carbamoylphenyl)carbamoyl]-2,2'-bipyridine-4-carboxylate. From a 1:1:1 reaction of [Pt(2)(bpy)(2)(μ-OH)(2)](NO(3))(2), RuBnH, and pivalamide, trinuclear complexes [Pt(2)(bpy)(2)(μ-RuBn)(μ-pivalamidato)](4+) (abbreviated as RuBn-Pt(2)) were isolated and characterized. Tetranuclear complexes [Pt(2)(bpy)(2)(μ-RuBn)(2)](6+) (abbreviated as (RuBn)(2)-Pt(2)) were separately prepared and characterized in detail. The quenching of the triplet excited state of the Ru(bpy)(3)(2+) derivative (i.e., Ru*(bpy)(3)(2+)) upon tethering the Pt(2)(bpy)(2)(μ-amidato)(2)(2+) moiety is strongly enhanced in RuB1-Pt(2) and (RuB1)(2)-Pt(2), while it is only slightly enhanced in RuB2-Pt(2) and (RuB2)(2)-Pt(2). These are partly explained by the driving forces for the electron transfer from the Ru*(bpy)(3)(2+) moiety to the Pt(2)(bpy)(2)(μ-amidato)(2)(2+) moiety (ΔG°(ET)); the ΔG°(ET) values for RuB1-Pt(2), (RuB1)(2)-Pt(2), RuB2-Pt(2), and (RuB2)(2)-Pt(2) are estimated as -0.01, 0.00, +0.22, and +0.28 eV, respectively. The considerable difference in the photochemical properties of the B1- and B2-bridged systems were further examined based on the emission decay and transient absorption measurements, which gave results consistent with the above conclusions.     

Ruthenium(II) Complexes with Three Different Diimine Ligands

The synthesis of tri-heteroleptic complex of Ru(II) with diimine ligands is describe. Ten compounds [Ru(R₂bpy) (biq) (L)][PF₆]₂ (R = H, CH₃); L = 2,2′-bipyridine (bpy), 4,4′-dimethyl-2,2′-bipyridine (Me₂bpy), 2,2′-bipyrimidine (bpm), 2,2′-biisoquinoline (biiq), 1,10-phenanthroline (phen), dipyrido[3,2-c:2′,3′-e]pyridazine (taphen), 2,2′-biquinoline (biq), 6,7-dihydrodipyrido[2,3-b:3,2-j][1,10]-phenanthroline (dinapy), 2-(2[pyridyl)quinoline (pq), 1-(2-pyrimidyl)pyrazole] (pzpm), 2,2′-biimidazole (H₂biim) are characterized by elemental analysis, electronic and ¹H-NMR spectroscopy. The relative photosustitution rates of biq in MeCN are given at three temperatures.     

Preparation and reactivity of mixed-ligand ruthenium(II) hydride complexes with phosphites and polypyridyls

Chloro complexes [RuCl(N-N)P3]BPh4 (1-3) [N-N = 2,2'-bipyridine, bpy; 1,10-phenanthroline, phen; 5,5'-dimethyl-2,2'-bipyridine, 5,5'-Me2bpy; P = P(OEt)3, PPh(OEt)2 and PPh2OEt] were prepared by allowing the [RuCl4(N-N)].H2O compounds to react with an excess of phosphite in ethanol. The bis(bipyridine) [RuCl(bpy)2[P(OEt)3]]BPh4 (7) complex was also prepared by reacting RuCl2(bpy)2.2H2O with phosphite and ethanol. Treatment of the chloro complexes 1-3 and 7 with NaBH4 yielded the hydride [RuH(N-N)P3]BPh4 (4-6) and [RuH(bpy)2P]BPh4 (8) derivatives, which were characterized spectroscopically and by the X-ray crystal structure determination of [RuH(bpy)[P(OEt)3]3]BPh4 (4a). Protonation reaction of the new hydrides with Br?nsted acid was studied and led to dicationic [Ru(eta2-H2)(N-N)P3]2+ (9, 10) and [Ru(eta(2-H2)(bpy)2P]2+ (11) dihydrogen derivatives. The presence of the eta2-H2 ligand was indicated by a short T(1 min) value and by the measurements of the J(HD) in the [Ru](eta2-HD) isotopomers. From T(1 min) and J(HD) values the H-H distances of the dihydrogen complexes were also calculated. A series of ruthenium complexes, [RuL(N-N)P3](BPh4)2 and [RuL(bpy)2P](BPh4)2 (P = P(OEt)3; L = H2O, CO, 4-CH3C6H4NC, CH3CN, 4-CH3C6H4CN, PPh(OEt)2], was prepared by substituting the labile eta2-H2 ligand in the 9, 10, 11 derivatives. The reactions of the new hydrides 4-6 and 8 with both mono- and bis(aryldiazonium) cations were studied and led to aryldiazene [Ru(C6H5N=NH)(N-N)P3](BPh4)2 (19, 21), [[Ru(N-N)P3]2(mu-4,4'-NH=NC6H4-C6H4N=NH)](BPh4)4 (20), and [Ru(C6H5N=NH)(bpy)2P](BPh4)2 (22) derivatives. Also the heteroallenes CO2 and CS2 reacted with [RuH(bpy)2P]BPh4, yielding the formato [Ru[eta1-OC(H)=O](bpy)2P]BPh4 and dithioformato [Ru[eta1-SC(H)=S](bpy)2P]BPh4 derivatives.     

Terpyridine- and bipyridine-based ruthenium complexes as catalysts for the Belousov-Zhabotinsky reaction

We report the successful use of Ru(II)(terpy)(2) (1, terpy = 2,2':6',2'-terpyridine) as a catalyst in the Belousov-Zhabotinsky (BZ) oscillating chemical reaction. We also examine several additional Ru(II) complexes, Ru(II)(bipy)(2)(L')(2) (2, L' = 4-pyridinecarboxylic acid; bipy = 2,2'-bipyridine) and Ru(II)(bipy)(2)(L') (3, L' = 4,4'-dicarboxy-2,2'-bipy; 4, L' = N-allyl-4'-methyl-[2,2'-bipy]-4-carboxamide; 5, L' = bipy), for catalyzing the BZ reaction. While 2 is unable to trigger BZ oscillations, probably because of the rapid loss of L' in a BZ solution, the other bipyridine-based Ru(II)-complexes can catalyze the BZ reaction, although their catalytic activity is adversely affected by slow ligand substitution in a BZ solution. Nevertheless, the successfully tested Ru(II)(terpy)(2) and Ru(II)(bipy)(2)(L') catalysts may provide useful building blocks for complex functional macromolecules.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Luminescent ruthenium(II) polypyridine biotin complexes: synthesis, characterization, photophysical and electrochemical properties, and avidin-binding studies

Two luminescent ruthenium(II) polypyridine complexes containing a biotin moiety [Ru(bpy)(2)(L1)](PF(6))(2) (1) and [Ru(bpy)(2)(L2)](PF(6))(2) (2) (bpy = 2,2'-bipyridine; L1 = 4-(N-((2-biotinamido)ethyl)amido)-4'-methyl-2,2'-bipyridine; L2 = 4-(N-((6-biotinamido)hexyl)amido)-4'-methyl-2,2'-bipyridine) have been synthesized and characterized, and their photophysical and electrochemical properties have been studied. Upon photoexcitation, complexes 1 and 2 display intense and long-lived triplet metal-to-ligand charge-transfer ((3)MLCT) (dpi(Ru) --> pi*(L1 or L2)) emission in fluid solutions at 298 K and in low-temperature glass. We have studied the binding of these ruthenium(II) biotin complexes to avidin by 4'-hydroxyazobenzene-2-carboxylic acid (HABA) assays, luminescence titrations, competitive assays using native biotin, and quenching experiments using methyl viologen. On the basis of the results of these experiments, a homogeneous competitive assay for biotin has been investigated.     

Dual emission from 3MLCT and 3ILCT excited states in a new Ru(II) diimine complex

The unique behavior of a new Ru(II) diimine complex, Ru(bpy)(2)(L)(2+) (where L is 4-methyl-4'-[p-(dimethyl- amino)-alpha-styryl]-2,2'-bipyridine, bpy is 2,2'-bipyridine), was studied in detail. Due to the strong electron donating property of the amino group, an ILCT (intraligand charge transfer) state is involved either in the absorption spectra or in the time-resolved emission spectra. Dual emission based on (3)MLCT and (3)ILCT states was observed at room temperature for the first time via a time-resolved technique in Ru(II) diimine complexes.