Synthesis and hybridization properties of oligonucleotides containing polyamines at the C-2 position of purines: a pre-synthetic approach for the incorporation of spermine into oligodeoxynucleotides containing 2-(4,9,13-triazatridecyl)-2'-deoxyguanosine

We have developed a synthesis of spermine-containing oligonucleotides (ODN-sper) which allows incorporation of multiple polyamine residues. This approach was based on the pertrifluoroacetylated 5'DMT-dGsper phosphoramidite synthon. Its coupling yield with resin-bound ODN decreased dramatically when close to the 3'-end. Optimization of the coupling conditions allowed 22-mer ODNs containing up to six spermine residues to be synthesized. Several ODNs of different sequences with 1-4 pendent spermines could be purified and their hybridization properties were evaluated. Duplex melting temperatures increased linearly with the number of polyamine residues (deltaTm/sper = 3.0 +/- 0.2 degrees C in 100mM NaCl). This compares very favorably with values reported for duplexes of similar initial stability containing other cation-substituted bases. Moreover, the stability increase was neither sequence nor position-dependent, and even contiguous spermine residues did not cross-talk. Extrapolation based on these findings leads to the conclusion that a duplex formed with a 22-mer oligonucleotide containing seven spermine residues would be as stable as genomic DNA, which highlights its potential for DNA strand invasion.     

Kinetic studies on the formation of DNA triplexes containing the nucleoside analogue 2'-O-(2-aminoethyl)-5-(3-amino-1-propynyl)uridine

We have examined the kinetics of triple helix formation of oligonucleotides that contain the nucleotide analogue 2'-O-(2-aminoethyl)-5-(3-amino-1-propynyl)uridine (bis-amino-U, BAU), which forms very stable base triplets with AT. Triplex stability is determined by both the number and location of the modifications. BAU-containing oligonucleotides generate triplexes with extremely slow kinetics, as evidenced by 14 degrees C hysteresis between annealing and melting profiles even when heated at a rate as slow as 0.2 degrees C min(-1). The association kinetics were measured by analysis of the hysteresis profiles, temperature-jump relaxation and DNase I footprinting. We find that the slow kinetics are largely due to the decreased rate of dissociation; BAU modification has little effect on the association reaction. The sequence selectivity is also due to the slower dissociation of BAU from AT than other base pairs.     

Lobatamide C: total synthesis,stereochemical assignment,preparation of simplified analogues,and V-ATPase inhibition studies

The total synthesis and stereochemical assignment of the potent antitumor macrolide lobatamide C, as well as synthesis of simplified lobatamide analogues, is reported. Cu(I)-mediated enamide formation methodology has been developed to prepare the highly unsaturated enamide side chain of the natural product and analogues. A key fragment coupling employs base-mediated esterification of a beta-hydroxy acid and a salicylate cyanomethyl ester. Three additional stereoisomers of lobatamide C have been prepared using related synthetic routes. The stereochemistry at C8, C11, and C15 of lobatamide C was assigned by comparison of stereoisomers and X-ray analysis of a crystalline derivative. Synthetic lobatamide C, stereoisomers, and simplified analogues have been evaluated for inhibition of bovine chromaffin granule membrane V-ATPase. The salicylate phenol, enamide NH, and ortho-substitution of the salicylate ester have been shown to be important for V-ATPase inhibitory activity.     

Efficient C2'alpha-hydroxylation of deoxyribose in protein-induced Z-form DNA

DNA local conformations are thought to play an important biological role in processes such as gene expression by altering DNA-protein interactions. Although left-handed Z-form DNA is one of the best-characterized and significant local structures of DNA, having been extensively investigated for more than two decades, the biological relevance of Z-form DNA remains unclear. This is presumably due to the lack of a versatile detection method in a living cell. Previously, we demonstrated that the incorporation of a methyl group at the guanine C8 position (m(8)G) dramatically stabilizes the Z-form of short oligonucleotides in a variety of sequences. To develop a photochemical method to detect Z-form DNA, we examined the photoreaction of 5-iodouracil-containing Z-form d(CGCG(I)UGCG)(ODN 1)/d(Cm(8)GCAm(8)GCG)(ODN 2) in 2 M NaCl and found stereospecific C2'alpha-hydroxylation occurred at G(4) to provide d(CGCrGUGCG), 5. Recently, Rich and co-workers [Schwartz et al. Science 1999, 284, 1841. Schwartz et al. Nat. Struct. Biol. 2001, 8, 761] found that an ubiquitous RNA editing enzyme, adenosine deaminase 1 (ADAR1), and tumor-associated protein DML-1 specifically bind to Z-form DNA. In the present study, we investigate the photoreactivity of octanucleotide ODN 1-2 in Z-form induced by Zalpha, which is the NH(2)-terminal domain of ADAR1 responsible for tight binding of ADAR1. Detailed product analysis revealed that the C2'alpha-hydroxylated products 5 and 6 produced significantly higher yields in Z-form ODN 1-2 induced by Zalpha compared with that in 2 M NaCl. Upon treatment with ribonuclease T1, 5 and 6 were quantitatively hydrolyzed at the 3'-phosphodiester bond of the rG residue to provide d(UGCG) as a common hydrolyzed fragment on the 3' side. Quantitative analysis demonstrated that the amount of photochemically formed 5 and 6 from ODN 1-2 directly correlated with the proportion of Z-form induced by Zalpha or NaCl. These results suggest that this photochemical and enzymatic procedure can be used as a specific probe for the existence of local Z-form structure in cellular DNA.     

Stereoselective reductions of N-Boc-hexahydro-1H-indolin-5(6H)-ones

We report the divergent effects of a 3a-methyl and 3a-phenyl substituent on the chemoselectivity and stereoselectivity of reduction of the enamide moiety of N-Boc-hexahydro-1H-indolin-5(6H)-ones. Under ionic reduction conditions (triethylsilane/trifluoroacetic acid) the enamide group of 3a-methyl-N-Boc-hexahydro-1H-indolin-5(6H)-one was reduced to afford exclusively a cis ring-fused product. For the 3a-phenyl substituted analogue more forcing conditions (sodium cyanoborohydride at pH 2-2.5) were required and resulted in the selective reduction of the enamide group to give a trans ring-fused product as well as reduction of the ketone group.     

Conformational analysis of the sixteen C(4)-C(6) and C(4)-C(8) linked dimers of (+)-catechin and (−)-epicatechin

A conformational analysis has been performed for sixteen dimers of (+)-catechin and/or (?)-epicatechin using molecular mechanics (MM2). Monomer units are linked by 4α-6, 4α-8, 4β-6, and 4β-8 bonds. THe four possible combinations of (+)-catechin and/or(?)-epicatechin are used for each bonding pattern. The objectives are characterization of (1) the two rotational isomers at the bond between the two monomer units and (2) the conformations of the heterocyclic rings. There is a twofold rotation about the bond between monomer units. Differ4ences in the energies at the two minima range from a few tenths of a kcal/mol to several kcal/mol, depending on the dimer Heterocyclic rings occupy a range of conformations that can be described as half chairs with varying degrees of distoration toward C(2) or C(3) sofas. The more frequent distortion is toward the C(2) sofa. Interconversion between most of the heterocyclic ring conformations can be obtained by coordinated motion of C(2) and C(3), over a range of about 40 pm, with respect to the mean plane of the fused aromatic ring system.     

Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides

The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.     

Synthesis of photoactivatable acyclic analogues of the lobatamides

[structure: see text] The lobatamides and related salicylate enamide natural products are potent mammalian V-ATPase inhibitors. To probe details of binding of the lobatamides to mammalian V-ATPase, three photoactivatable analogues bearing benzophenone photoaffinity labels have been prepared. The analogues were designed on the basis of a simplified acyclic analogue 2. Late-stage installation of the enamide side chain and tandem deallylation/amidation were employed in synthetic routes to these derivatives. Simplified analogue 2 showed strong inhibition against bovine clathrin-coated vesicle V-ATPase (10 nM). Analogues 3-5 were also evaluated for inhibition of bovine V-ATPase in order to select a suitable candidate for future photoaffinity labeling studies.     

Synthesis and properties of RNA analogues having amides as interuridine linkages at selected positions

Oligoribonucleotide analogues having amide internucleoside linkages (AM1: 3'-CH(2)CONH-5' and AM2: 3'-CH(2)NHCO-5') at selected positions have been synthesized and the thermal stability of duplexes formed by these analogues with complementary RNA fragments has been evaluated by UV melting experiments. Two series of oligomers with either 2'-OH or 2'-OMe vicinal to the amide linkages were studied. Monomeric synthons (3' and 5'-C amines and carboxylic acids) were synthesized as follows: For synthesis of the AM1 analogue, the known sequence of radical allylation followed by the cleavage of the double bond was adopted. For synthesis of the AM2 analogue, novel routes via addition of nitromethane followed by conversion of the nitro function to either amino or carboxyl groups were developed. Coupling of monomeric amines and carboxylic acids followed by protecting group manipulation and phosphonylation gave dimeric 3'-hydrogenphosphonate building blocks for oligonucleotide synthesis. Monomeric model compounds having 3'-amide and 2'-OH or 2'-OMe groups were also prepared and their conformational equilibrium was determined by (1)H NMR. The AM1 and AM2 models showed equal preferences for the North conformers (at 40 degrees C, 88-89% with 2'-OH, and 92-93% with 2'-OMe). At physiological salt concentration (0.1 M NaCl) the duplexes between AM1 modified oligonucleotides and RNA had stability similar to unmodified RNA-RNA duplexes (Delta t(m)= -0.2 to +0.7 degrees C per modification). However, the AM2 modification resulted in substantial stabilization of duplexes: Delta t(m)= +1 to +2.4 degrees C per modification compared to all RNA. A 2'-O-methyl vicinal to the AM2 linkage further increased the duplex stability. Our results suggest that RNA analogues having amide internucleoside bonds are very promising candidates for medicinal applications.     

Independent generation and characterization of a C2'-oxidized abasic site in chemically synthesized oligonucleotides

Abasic lesions, which are formed endogenously and as a consequence of exogenous agents, are lethal and mutagenic. Hydrogen atom abstraction from C2' in DNA under aerobic conditions produces an oxidized abasic lesion (C2-AP), along with other forms of DNA damage. The effects of C2-AP on DNA structure and function are not well understood. A method for the solid-phase synthesis of oligonucleotides containing C2-AP lesions is reported. The lesion is released via periodate oxidation of a triol containing a vicinal diol. The triol is introduced via a phosphoramidite that is compatible with standard oligonucleotide synthesis and deprotection conditions. UV-melting studies indicate that the C2-AP lesion has a comparable effect on the thermal stability of duplex DNA as other abasic lesions. The C2-AP lesion is rapidly cleaved by piperidine at 90 degrees C. However, cleavage by NaOH (0.1 M, 37 degrees C) shows that C2-AP is considerably less labile (t(1/2) = 3.3 +/- 0.2 h) than other abasic lesions.     

Conformational equilibria in formic acid and the adduct of formic acid and hexafluoroacetone, HCO2C(CF3)2OH

Low-temperature 1H and 13C NMR spectra of formic acid (1) showed separate signals for the E and Z conformations in solvents containing a hydrogen bond acceptor, dimethyl ether. The population of E-1 (6.2% in 3:1:1 CHClF2/CHCl2F/(CH3)2O) was larger than that for 13C-labeled methyl formate in the same solvent (0.2%), which indicated that the relative populations are not determined by steric effects. The free-energy difference between the E and Z conformations of 1 was 0.9 kcal/mol. In a 1:3 CD2Cl2/(CH3)2O solvent mixture, peaks for E and Z conformations were found at low temperatures by 1H and 13C NMR for both formic acid and an adduct with hexafluoroacetone, HCO2C(CF3)2OH (2). The population of E-1 in this solvent mixture was 4.3% by 13C NMR. The carbon spectrum showed two peaks in the carbonyl carbon region of nearly equal intensities at -151.6 degrees C, with E-2 (48%) absorbing downfield of the major Z-2 (52%). The large population of E-2 confirms that electron-withdrawing groups R' in RCO2R' enhance the populations of the E-isomers. The free-energy barriers for 2 of 6.24 (E-to-Z) and 6.26 kcal/mol (Z-to-E) were determined from rate constants obtained by line shape analysis at -143.2 degrees C.     

Metal ion coordination to azole nucleosides

To evaluate the possibility of introducing azole nucleosides as building blocks for metal-mediated base pairs in artificial oligonucleotides, imidazole nucleoside, 1,2,4-triazole nucleoside and tetrazole nucleoside have been synthesized and characterized. The X-ray crystal structures of p-toluoyl-protected 1,2,4-triazole and tetrazole nucleosides are reported. Contrary to the situation primarily found for deoxyribonucleosides, the sugar moieties adopt C3'-endo conformations. The acidity of the beta nucleosides increases with increasing number of nitrogen ring atoms, giving pKa values of 6.01 +/- 0.05, 1.32+/-0.05 and <-3, respectively. This decrease in basicity results in a decreasing ability to form 2:1 complexes with linearly coordinating metal ions such as Ag+ and Hg2+. In all cases, the Ag+ complexes are of higher stability than the corresponding Hg2+ complexes. Whereas imidazole nucleoside forms highly stable 2:1 complexes with both metal ions (estimated log beta2 values of >10), only Ag+ is able to reach this coordination pattern in the case of triazole nucleoside (log beta2 = 4.3 +/- 0.1). Tetrazole nucleoside does not form 2:1 complexes at all under the experimental conditions used. These data suggest that imidazole nucleoside, and to a lesser extent 1,2,4-triazole nucleoside, are likely candidates for successful incorporation as ligands in oligonucleotides based on metal-mediated base pairs. DFT calculations further corroborate this idea, providing model complexes for such base pairs with glycosidic bond distances (10.8-11.0 Angstroms) resembling those in idealized B-DNA (10.85 Angstroms).     

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.     

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.     

Celogentins A-C, new antimitotic bicyclic peptides from the seeds of Celosia argentea

Three new bicyclic peptides, celogentins A (1), B (2), and C (3), have been isolated together with a known-related peptide, moroidin (4), from the seeds of Celosia argentea, and their structures including absolute stereochemistry were determined by using extensive NMR methods and chemical means. Celogentins A (1), B (2), and C (3) inhibited the polymerization of tubulin, and celogentin C (3) was four times more potent than moroidin (4) in the inhibitory activity. Structure-activity relationship study using moroidin derivatives 5-7 and analogue 8 as well as celogentins A-C (1-3) and moroidin (4) indicates that the bicyclic ring system including unusual non-peptide connections among beta(s)-Leu, Trp, and His residues characteristic of celogentins and moroidin, with ring size and conformations suitable for interaction with tubulin would be important for their biological activity.     

Conformational study of 1,2-cycloundecadiene by dynamic NMR spectroscopy and computational methods

Solutions of 1,2-cycloundecadiene in propane were studied by low-temperature (13)C NMR spectroscopy. A total of 17 peaks were observed at -166.7 degrees C, corresponding to two conformations of similar populations, one of C(1) symmetry (11 peaks) and the other of C(2) symmetry. The line shapes show that the predominant pathway for exchange of the topomers (C(1) and C(1)') of the C(1) conformation does not include the C(2) conformation. From the (13)C spectra, free-energy barriers of 8.38 +/- 0.15, 9.45 +/- 0.15, and 9.35 +/- 0.15 kcal/mol were determined for the C(1) to C(1)', (C(1) + C(1)') to C(2), and C(2) to (C(1) + C(1)') conversions, respectively, at -72.2 degrees C. The NMR results for this compound are discussed in terms of the conformations predicted by molecular mechanics calculations obtained with Allinger's MM3 program. Ab initio calculations of free energies are also reported at the HF/ 6-311G level for 25 conformations.     

Preparation and conformational properties of the perfluoro diether CF(3)OCF(2)OCF(2)C(O)F, a model molecule to study properties of perfluoro polyethers

The compound CF(3)OCF(2)OCF(2)C(O)F was prepared by oxidation of hexafluoropropene with molecular oxygen in the gas-phase using CF(3)OF as initiator. (13)C NMR, FTIR, Raman, UV-vis, and mass spectra were obtained and interpreted. The theoretical structure studies were performed by the calculation of the potential energy surfaces, using the results obtained for a smaller related molecule, CF(3)OCF(2)C(O)F, as a starting point. A high degree of conformational flexibility of this compound is evidenced by the values of several conformations, varying within the range of 1 kcal/mol. Theoretical calculations predict chain conformations as the most stable molecular forms, as expected from the presence of the anomeric effect. The experimental fundamental vibrational modes are compared with those obtained theoretically, using ab initio and density functional theory methods, HF/6-31+G and B3LYP/6-31+G, respectively. The density of the compound at ambient temperature (delta = 1.7(1) g/mL), its melting point (mp = -140(5) degrees C), its boiling point (bp = 14.5 (1) degrees C), and the relation between its vapor pressure and the absolute temperature (ln P = 13.699 - 2023.4/T) were also determined.     

2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

[structure: see text] Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA (DeltaT(m) 3.2 degrees C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 A resolution.     

Synthesis of a Type-VIβ-Turn Peptide Mimetic and Its Incorporation into a High-Affinity Somatostatin Receptor Ligand

The synthesis of a cis-Phe-Pro dipeptide mimetic is described, which adopts a type-VIβ-turn conformation. In this mimetic, the α-positions of Phe and Pro are joined by a CH₂CH₂ bridge, thereby forming a fused bicyclic system, and fixing a geometry similar to that seen in cis-Phe-Pro units in protein crystal structures. The dipeptide mimetic 20 was synthesized in optically pure form starting from (R)-α-allylproline ( 6 ; Schemes 1, 3, and 4), with a free carboxylic acid and an Fmoc-protected N-terminus, thereby allowing its incorporation into linear and cyclic peptides using standard solid-phase methods. The mimetic 20 was incorporated into the cyclic somatostatin analogue cyclo(-Phe = Pro-Phe-D -Trp-Lys-Thr-), where Phe = Pro represents the mimetic. This analogue shows a high affinity (pIC₅₀ 8.6) for somatostatin receptors on rat-brain cortex membranes. Based on NMR studies in aqueous solution, likely low-energy conformations for this analogue were deduced using restrained dynamic simulated annealing. The conformations found, which include a distorted type-II′ turn at D -Trp-Lys, are similar to low-energy conformations deduced elsewhere for cyclo(-Phe-Pro-Phe-D -Trp-Lys-Thr-), as well as to those seen in crystal structures of the somatostatin analogue octreotide.     

A solution to the component instability problem in the preparation of peptides containing C2-substituted cis-cyclobutane β-aminoacids: synthesis of a stable rhodopeptin analogue

Despite the inherent instability of C2-substituted cis-cyclobutane β-aminoacids, incorporation of such residues into peptides is shown to be possible through use of a 1-amino-2-(hydroxymethyl)cyclobutane derivative as a stable β-aminoacid surrogate. This synthetic strategy was validated by the synthesis of a rhodopeptin analogue.