共查询到20条相似文献,搜索用时 328 毫秒
1.
Gallagher LA Serron SA Wen X Hornstein BJ Dattelbaum DM Schoonover JR Meyer TJ 《Inorganic chemistry》2005,44(6):2089-2097
Photocurrent measurements have been made on nanocrystalline TiO2 surfaces derivatized by adsorption of a catalyst precursor, [Ru(tpy)(bpy(PO3H2)2)(OH2)]2+, or chromophore, [Ru(bpy)2 (bpy(PO3H2)2)]2+ (tpy is 2,2':6',2' '-terpyridine, bpy is 2,2'-bipyridine, and bpy(PO3H2)2 is 2,2'-bipyridyl-4,4'-diphosphonic acid), and on surfaces containing both complexes. This is an extension of earlier work on an adsorbed assembly containing both catalyst and chromophore. The experiments were carried out with the I3-/I- or quinone/hydroquinone (Q/H2Q) relays in propylene carbonate, propylene carbonate-water mixtures, and acetonitrile-water mixtures. Electrochemical measurements show that oxidation of surface-bound Ru(III)-OH2(3+) to Ru(IV)=O(2+) is catalyzed by the bpy complex. Addition of aqueous 0.1 M HClO4 greatly decreases photocurrent efficiencies for adsorbed [Ru(tpy)(bpy(PO3H2)2)(OH2)]2+ with the I3-/I- relay, but efficiencies are enhanced for the Q/H2Q relay in both propylene carbonate-HClO4 and acetonitrile-HClO4 mixtures. The dependence of the incident photon-to-current efficiency (IPCE) on added H2Q in 95% propylene carbonate and 5% 0.1 M HClO4 is complex and can be interpreted as changing from rate-limiting diffusion to the film at low H2Q to rate-limiting diffusion within the film at high H2Q. There is no evidence for photoelectrochemical cooperativity on mixed surfaces containing both complexes with the IPCE response reflecting the relative surface compositions of the two complexes. These results provide insight into the possible design of photoelectrochemical synthesis cells for the oxidation of organic substrates. 相似文献
2.
Three novel BPTC complexes, (H(2)BPTC)(4,4'-H(2)bpy)H(2)O (1), [Cd(2)Cu(HBPTC)(2)(mu(2)-4,4'-bpy)(2)(4,4'-bpy)(2)(H(2)O)(2)](n) (2), and [Co(3)(HBPTC)(2)(mu(2)-4,4'-bpy)(3)(H(2)O)(4)](n).2nH(2)O (3) (BPTC = 3,3',4,4'-benzophenone-tetracarboxylate and bpy = bipyridine), were hydrothermally synthesized. Complex 1, which is obtained as a coproduct during the syntheses of complexes 2 and 3, features a 2-D layered strong hydrogen bonding network with 2-fold interpenetration. Complex 2 has an unusual 2-D double-layered motif, which is linked together by Cu atoms in a face-to-face manner. It exhibits nanosized channels filled by 4,4'-bpy ligands. Three six-coordinated Co atoms in 3 are interlinked by HBPTC ligands to form a 2-D grid structure, which is further sustained by rigid 4,4'-bpy ligands into a 3-D open framework similar to CdSO(4) with the BPTC moieties situated in the tunnels. The thermal stabilities of complexes 1-3 were examined. The photoluminescence properties of complexes 1-2 and temperature-dependent magnetic susceptibility for 3 were also studied. 相似文献
3.
Three 3D robust homochiral helical coordination polymers, [Cu(2,2',3,3'-H2odpa)(bpy)] (1), {[Ni4(2,2',3,3'-odpa)2(bpy)4(H2O)4].(H2O)16} (2), and {[Co4(2,2',3,3'-odpa)2(bpy)4(H2O)4].(H2O)14} (3), have been hydrothermally synthesized from a flexible ligand of 2,2',3,3'-odpda (2,2',3,3'-oxydiphthalic dianhydride). Compound 1 crystallized in space group P3(1)21 and has a rare chiral dense qzd 7.(5)9 topology that incorporates single helical substructures with the same accessibility, whereas compounds 2 and 3 crystallized in the space group C2 and possessed isostructural 3D chiral open frameworks based on the homochiral 2D sheets and 4,4'-bpy pillars. TGA and PXRD analyses show that the porous framework of 2 is stable after the removal of solvent water molecules. In contrast, 3 changed its structure to an amorphous one because of the simultaneous loss of solvent and coordination water molecules. 1 is nearly paramagnetic, whereas weak ferromagnetic interactions between M(II) (M = Ni, Co) ions have been found in 2 and 3. 相似文献
4.
Zilu Chen Fupei Liang Xingfu Tang Mansheng Chen Lihua Song Ruixiang Hu 《无机化学与普通化学杂志》2005,631(15):3092-3095
Two nitrilotriacetate cobalt complexes {[CoK2(NTA)(Hmta)(H2O)3]NO3}n ( 1 ) and [{Co(4,4′‐bpy)2(H2O)4}{Co2(NTA)2(4,4′‐bpy)(H2O)2}] ( 2 ) (NTA = nitrilotriacetate anion, Hmta = hexamethylenetetramine and 4,4′‐bpy = 4,4′‐bipyridine) were prepared and characterized by IR, elemental analysis and single crystal X‐ray diffraction study. The influence of the neutral ancillary ligands on the formation of the complexes with different structures in the Co‐NTA system was discussed. The coordination of NTA and Hmta to Co2+ ions only resulted in the formation of mononuclear [Co(NTA)(Hmta)]? ions which are further connected by K+ ions and water molecules to form a three‐dimensional network. The use of 4,4′‐bpy as ancillary ligand in 2 led to the formation of separate mononuclear [Co(4,4′‐bpy)2(H2O)4]2+ and dinuclear [Co2(NTA)2(4,4′‐bpy)(H2O)2]2? which are further connected by hydrogen bonds to form a supramolecular three‐dimensional network. In these cases it seems to suggest that the addition of neutral ancillary ligand into the Co‐NTA system leads to the formation of lower dimensional structures when the contribution of alkali ions to the structural dimensionality is neglected. 相似文献
5.
Spillane CB Smith JA Buck DP Collins JG Keene FR 《Dalton transactions (Cambridge, England : 2003)》2007,(45):5290-5296
1H NMR spectroscopy and molecular modelling have been used to investigate the binding of the DeltaDelta-and LambdaLambda-enantiomers of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [Me2bpy = 4,4'-dimethyl-2,2'-bipyridine; bpm = 2,2'-bipyrimidine] to an RNA tridecanucleotide duplex containing a single-base bulge [r(CCGAGAAUUCCGG)2]], and the corresponding control dodecanucleotide [r(CCGGAAUUCCGG)2]. Both enantiomers bound the control RNA sequence weakly. From upfield shifts of the metal complex H3 and H3' protons throughout the titration of the control dodecanucleotide with DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+, a binding constant of 1 x 10(3) M(-1) was determined. In NOESY spectra of the control sequence with added DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+, NOEs were only observed to protons from the terminal base-pair residues. No significant changes in chemical shift were observed for either the metal complex or RNA protons upon addition of the LambdaLambda-enantiomer to the control dodecanucleotide. The DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ complex bound the bulge-containing RNA with a significantly greater affinity (6 x 10(4) M(-1)) than the non-bulge control RNA duplex. Competition binding experiments indicated that the LambdaLambda-isomer bound the tridecanucleotide with similar affinity to the DeltaDelta-enantiomer. Addition of DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ to the bulge-containing tridecanucleotide induced selective changes in chemical shift for the base H8 and sugar H1' resonances from the adenine bulge residue, and resonances from nucleotide residues adjacent to the bulge site. Intermolecular NOEs observed in NOESY spectra of the tridecanucleotide with added DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ confirmed the selective binding of the ruthenium complex at the bulge site. Preliminary binding models, consistent with the NMR data, showed that the ruthenium complex could effectively associate in the RNA minor groove at the bulge site. 相似文献
6.
Geary EA McCall KL Turner A Murray PR McInnes EJ Jack LA Yellowlees LJ Robertson N 《Dalton transactions (Cambridge, England : 2003)》2008,(28):3701-3708
A series of [Pt(ii)(diimine)(dithiolate)] complexes of general formula [Pt{X,X'-(CO(2)R)(2)-bpy}(mnt)] (where X = 3, 4 or 5; R = H or Et, bpy = 2,2'-bipyridyl and mnt = maleonitriledithiolate), have been spectroscopically, electrochemically and computationally characterised and compared with the precursors [Pt{X,X'-(CO(2)R)(2)-bpy}Cl(2)] and X,X'-(CO(2)R)(2)-bpy. The study includes cyclic voltammetry, in situ EPR spectroelectrochemical studies of fluid solution and frozen solution samples, UV/Vis/NIR spectroelectrochemistry, hyrid DFT and TD-DFT calculations. The effect of changing the position of the bpy substituents from 3,3' to 4,4' and 5,5' is discussed with reference to electronic changes seen within the different members of the family of molecules. The performance of the mnt complexes in dye-sensitised solar cells has been previously described and the superior performance of [Pt{3,3'-(CO(2)R)(2)-bpy}(mnt)] is now explained in terms of decreased electronic delocalisation through twisting of the bipyridyl ligand as supported by the EPR and computational results. 相似文献
7.
Kepert CM Deacon GB Sahely N Spiccia L Fallon GD Skelton BW White AH 《Inorganic chemistry》2004,43(9):2818-2827
The reactions of bidentate diimine ligands (L2) with binuclear [Ru(L1)(CO)Cl2]2 complexes [L1 not equal to L2 = 2,2'-bipyridine (bpy), 4,4'-dimethyl-2,2'-bipyridine (4,4'-Me2bpy), 5,5'-dimethyl-2,2'-bipyridine (5,5'-Me2bpy), 1,10-phenanthroline (phen), 4,7-dimethyl-1,10-phenanthroline (4,7-Me2phen), 5,6-dimethyl-1,10-phenanthroline (5,6-Me2phen), di(2-pyridyl)ketone (dpk), di(2-pyridyl)amine (dpa)] result in cleavage of the dichloride bridge and the formation of cationic [Ru(L1)(L2)(CO)Cl]+ complexes. In addition to spectroscopic characterization, the structures of the [Ru(bpy)(phen)(CO)Cl]+, [Ru(4,4'-Me2bpy)(5,6-Me2phen)(CO)Cl]+ (as two polymorphs), [Ru(4,4'-Me2bpy)(4,7-Me2phen)(CO)Cl]+, [Ru(bpy)(dpa)(CO)Cl]+, [Ru(5,5'-Me2bpy)(dpa)(CO)Cl]+, [Ru(bpy)(dpk)(CO)Cl]+, and [Ru(4,4'-Me2bpy)(dpk)(CO)Cl]+ cations were confirmed by single crystal X-ray diffraction studies. In each case, the structurally characterized complex had the carbonyl ligand trans to a nitrogen from the incoming diimine ligand, these complexes corresponding to the main isomers isolated from the reaction mixtures. The synthesis of [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)(NO3)]+ from [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)Cl]+ and AgNO3 demonstrates that exchange of the chloro ligand can be achieved. 相似文献
8.
Xiao DR Wang EB An HY Li YG Su ZM Sun CY 《Chemistry (Weinheim an der Bergstrasse, Germany)》2006,12(25):6528-6541
Rational self-assembly of a long V-shaped 3,3',4,4'-benzophenonetetracarboxylate (bptc) ligand and metal salts in the presence of linear bidentate ligand yield a series of novel pillared helical-layer complexes, namely, [Cu2(bptc)(bpy)2] (1), [M3(Hbptc)2(bpy)3(H2O)4].2 H2O (M = Fe(2) and Ni(3)), [Co2(bptc)(bpy)(H2O)].0.5 bpy (4), [Cd2(bptc)(bpy)(H2O)2].H2O (5), [Mn2(bptc)(bpy)1.5(H2O)3] (6) and [M2(bptc)(bpy)0.5(H2O)5].0.5 bpy (M = Mn(7), Mg(8) and Co(9), bpy=4,4'-bipyridine). Their structures were determined by single-crystal X-ray diffraction analyses and further characterized by elemental analyses, IR spectra, and thermogravimetric (TG) analyses. The structure of 1 consists of two types of chiral layers, one left-handed and the other right-handed, which are connected by bpy pillars to generate a novel 3D open framework featuring four distinct helical chains. Compounds 2 and 3 are isostructural and feature 3D structures formed from the interconnection of arm-shaped helical layers with bpy pillars. Compound 4 is a pillared helical double-layer complex containing four different types of helices, among which the nine-fold interwoven helices constructed from triple-stranded helical motifs are unprecedented. Compound 5 exhibits a novel 3D covalent framework which features nanosized tubular channels. These channels are built from helical layers pillared by bptc ligands. The structure of 6 is constructed from {Mn(bptc)(H2O)}n2n- layers, which consist of left- and right-handed helical chains, pillared by [Mn2(bpy)3(H2O)4]4+ complexes into a 3D framework. To the best of our knowledge, compounds 1-6 are the first examples of pillared helical-layer coordination polymers. Compounds 7-9 are isostructural and exhibit interesting 2D helical double-layer structures, which are constructed from {M(bptc)(H2O)2}n2n- ribbons cross-linked by [M2(bpy)(H2O)6]4+ complexes. Furthermore, the 3D supramolecular structures of 7-9 are similar to the 3D structure of 6, and the 2D structure of 7 can be transformed into the 3D structure of 6 at higher reaction temperature. By inspection of the structures of 1-9, it is believed that the V-shaped bptc ligand and V-shaped phthalic group of the bptc ligand are important for the formation of the helical structures. The magnetic behavior of compounds 1, 2, 4, 6, and 9 was studied and indicated the existence of antiferromagnetic interactions. Moreover, compound 5 shows intense photoluminescence at room temperature. 相似文献
9.
New hybrid complexes of polypyridyl ruthenium and pyridylporphyrins have been prepared by the coordination of pyridyl nitrogens to the ruthenium centers. A 1:4 hybrid complex, [{Ru(bpy)(trpy)}4(mu4-H2Py4P)]8+ ([1]8+) (bpy = 2,2'-bipyridine; trpy = 2,2':6',2"-terpyridine; H2Py4P = 5,10,15,20-tetra(4-pyridyl)porphyrin), has been characterized by the single-crystal X-ray diffraction method. A 1:1 complex, [{Ru(bpy)(trpy)}(H2PyT3P)]2+ ([2]2+) (H2PyT3P = 5-(4-pyridyl)tritolylporphyrin) has also been prepared. The Soret band of the porphyrin ring shifts to longer wavelength with some broadening, the extent of the shift being larger for [1]8+. Cyclic voltammograms of the two complexes show simple overlap of the component redox waves. The complexes are weakly emissive at room temperature, which becomes stronger at lower temperatures. While [1]8+ at >140 K and [2]2+ at 77-280 K show only porphyrin fluorescence, [1]8+ at <140 K shows ruthenium and porphyrin phosphorescence, in addition to the porphyrin fluorescence. 相似文献
10.
Kepert CM Bond AM Deacon GB Spiccia L Skelton BW White AH 《Dalton transactions (Cambridge, England : 2003)》2004,(11):1766-1774
The reactions of bidentate diimine ligands (L2) with cationic bis(diimine)[Ru(L)(L1)(CO)Cl]+ complexes (L, L1, L2 are dissimilar diimine ligands), in the presence of trimethylamine-N-oxide (Me3NO) as a decarbonylation reagent, lead to the formation of heteroleptic tris(diimine) ruthenium(II) complexes, [Ru(L)(L1)(L2)]2+. Typically isolated as hexafluorophosphate or perchlorate salts, these complexes were characterised by UV-visible, infrared and mass spectroscopy, cyclic voltammetry, microanalyses and NMR spectroscopy. Single crystal X-ray studies have elucidated the structures of K[Ru(bpy)(phen)(4,4'-Me(2)bpy)](PF(6))(3).1/2H(2)O, [Ru(bpy)(5,6-Me(2)phen)(Hdpa)](ClO(4))(2), [Ru(bpy)(phen)(5,6-Me(2)phen)](ClO(4))(2), [Ru(bpy)(5,6'-Me(2)phen)(4,4'-Me(2)bpy)](PF(6))(2).EtOH, [Ru(4,4'-Me(2)bpy)(phen)(Hdpa)](PF(6))(2).MeOH and [Ru(bpy)(4,4'-Me(2)bpy)(Hdpa)](ClO(4))(2).1/2Hdpa (where Hdpa is di(2-pyridyl)amine). A novel feature of the first complex is the presence of a dinuclear anionic adduct, [K(2)(PF(6))(6)](4-), in which the two potassium centres are bridged by two fluorides from different hexafluorophosphate ions forming a K(2)F(2) bridging unit and by two KFPFK bridging moieties. 相似文献
11.
The known Os(IV)-cyanoimido complexes, mer-Et4N[OsIV(bpy)(Cl)3(NalphaCNbeta)] (mer-[OsIV=N-CN]-) (bpy = 2,2'-bipyridine) and trans-[OsIV(tpy)(Cl)2(NalphaCNbeta)] (trans-[OsIV=N-CN]) (2,2':6',2' '-terpyridine), have formal electronic relationships with high oxidation state Ru and Os-oxo and -dioxo complexes. These include multiple bonding to the metal, the ability to undergo multiple electron transfer, and the availability of nonbonding electron pairs for donation. Thermodynamic, oxo-like behavior is observed for mer-[OsIV=N-CN]- in the pH-dependence of its Os(VI/V) to Os(III/II) redox couples in 1:1 (v/v) CH3CN:H2O. Oxo-like behavior is also observed in the reaction between mer-[OsVI(bpy)(Cl)3(NalphaCNbeta)]PF6 and benzyl alcohol to give mer-[OsIV(bpy)(Cl)3(NalphaCNbetaH2)]PF6 and benzaldehyde. The reaction is first order in each reactant with kbenzyl(CH3CN, 25.0 +/- 0.1 degrees C) = (8.6 +/- 0.2) x 102 M-1 s-1. Formal NCN degrees transfer, analogous to O-atom transfer, occurs in reactions with tertiary phosphine and hexenes. In CH3CN under N2, a rapid reaction occurs between trans-[OsIV=N-CN] and PPh3 (kPPh3(DMF, 25.0 +/- 0.1 degrees C) = 4.06 +/- 0.02 M-1 s-1) to form the nitrilic N-bound Os(II)-(N-cyano)iminophosphorano product, trans-[OsII(tpy)(Cl)2(NalphaCNbetaPPh3)] (trans-[OsII-NalphaC-Nbeta=PPh3]). It undergoes solvolysis at 45 degrees C after 24 h to give trans-[OsII(tpy)(Cl)2(NCCH3)] and (N-cyano)iminophosphorane (NalphaC-Nbeta=PPh3). The analogue to epoxidation, N-cyanoaziridination of cyclohexene and 1-hexene by mer-[OsIV=N-CN]- and trans-[OsIV=N-CN], occurs at Nbeta to give the Os(IV)-N-cyanoaziridino complexes, mer-Et4N[OsII(bpy)(Cl)3(NalphaCNbetaC6H10)] and trans-[OsII(tpy)(Cl)2(NalphaCNbetaC6H11)], respectively. Oxidation to mer-[OsV(bpy)(Cl)3(NalphaCNbeta)]- greatly accelerates N-cyanoaziridination of cyclohexene, which is followed by slow solvolysis to give mer-[OsIII(bpy)(Cl)3(NCCH3)] and N-cyanoaziridine (NC-NC6H10). The Os-(N-cyano)aziridino complexes are the first well-characterized examples of coordinated cyanoaziridines. 相似文献
12.
Brietzke T Mickler W Kelling A Holdt HJ 《Dalton transactions (Cambridge, England : 2003)》2012,41(9):2788-2797
We report the synthesis of free 1,6,7,12-tetraazaperylene (tape). Tape was obtained from 1,1'-bis-2,7-naphthyridine by potassium promoted cyclization followed by oxidation with air. Mono- and dinuclear ruthenium(II) 1,6,7,12-tetraazaperylene complexes of the general formulas [Ru(L-L)(2)(tape)](PF(6))(2), [1](PF(6))(2)-[5](PF(6))(2), and [{Ru(L-L)(2)}(2)(μ-tape)](PF(6))(4), [6](PF(6))(4)-[10](PF(6))(4), with{L-L = phen, bpy, dmbpy (4,4'-dimethyl-2,2'-bipyridine), dtbbpy (4,4'-ditertbutyl-2,2'-bipyridine) and tmbpy (4,4'5,5'-tetramethyl-2,2'-bipyridine)}, respectively, were synthesized. The X-ray structures of tape·2CHCl(3) and the mononuclear complexes [Ru(bpy)(2)(tape)](PF(6))(2)·0.5CH(3)CN·0.5toluene, [Ru(dmbpy)(2)(tape)](PF(6))(2)·2toluene and [Ru(dtbbpy)(2)(tape)](PF(6))(2)·3acetone·0.5H(2)O were solved. The UV-vis absorption spectra and the electrochemical behavior of the ruthenium(ii) tape complexes were explored and compared with the data of the analogous dibenzoeilatin (dbneil), 2,2'-bipyrimidine (bpym) and tetrapyrido[3,2-a:2',3'-c:3',2'-h:2',3'-j]phenazin (tpphz) species. 相似文献
13.
The oxidation of benzaldehyde and several of its derivatives to their carboxylic acids by cis-[Ru(IV)(bpy)2(py)(O)]2+ (Ru(IV)=O2+; bpy is 2,2'-bipyridine, py is pyridine), cis-[Ru(III)(bpy)2(py)(OH)]2+ (Ru(III)-OH2+), and [Ru(IV)(tpy)(bpy)(O)]2+ (tpy is 2,2':6',2'-terpyridine) in acetonitrile and water has been investigated using a variety of techniques. Several lines of evidence support a one-electron hydrogen-atom transfer (HAT) mechanism for the redox step in the oxidation of benzaldehyde. They include (i) moderate k(C-H)/k(C-D) kinetic isotope effects of 8.1 +/- 0.3 in CH3CN, 9.4 +/- 0.4 in H2O, and 7.2 +/- 0.8 in D2O; (ii) a low k(H2O/D2O) kinetic isotope effect of 1.2 +/- 0.1; (iii) a decrease in rate constant by a factor of only approximately 5 in CH3CN and approximately 8 in H2O for the oxidation of benzaldehyde by cis-[Ru(III)(bpy)2(py)(OH)]2+ compared to cis-[Ru(IV)(bpy)2(py)(O)]2+; (iv) the appearance of cis-[Ru(III)(bpy)2(py)(OH)]2+ rather than cis-[Ru(II)(bpy)2(py)(OH2)]2+ as the initial product; and (v) the small rho value of -0.65 +/- 0.03 in a Hammett plot of log k vs sigma in the oxidation of a series of aldehydes. A mechanism is proposed for the process occurring in the absence of O2 involving (i) preassociation of the reactants, (ii) H-atom transfer to Ru(IV)=O2+ to give Ru(III)-OH2+ and PhCO, (iii) capture of PhCO by Ru(III)-OH2+ to give Ru(II)-OC(O)Ph+ and H+, and (iv) solvolysis to give cis-[Ru(II)(bpy)2(py)(NCCH3)]2+ or the aqua complex and the carboxylic acid as products. 相似文献
14.
There is a remarkable redox chemistry of higher oxidation state M(IV)-M(VI) polypyridyl complexes of Ru and Os. They are accessible by proton loss and formation of oxo or nitrido ligands, examples being cis-[RuIV(bpy)2(py)(O)]2+ (RuIV=O2+, bpy=2,2'-bipyridine, and py=pyridine) and trans-[OsVI(tpy)(Cl)2(N)]+ (tpy=2,2':6',2' '-terpyridine). Metal-oxo or metal-nitrido multiple bonding stabilizes the higher oxidation states and greatly influences reactivity. O-atom transfer, hydride transfer, epoxidation, C-H insertion, and proton-coupled electron-transfer mechanisms have been identified in the oxidation of organics by RuIV=O2+. The Ru-O multiple bond inhibits electron transfer and promotes complex mechanisms. Both O atoms can be used for O-atom transfer by trans-[RuVI(tpy)(O)2(S)]2+ (S=CH3CN or H2O). Four-electron, four-proton oxidation of cis,cis-[(bpy)2(H2O)RuIII-O-RuIII(H2O)(bpy)2]4+ occurs to give cis,cis-[(bpy)2(O)RuV-O-RuV(O)(bpy)2]4+ which rapidly evolves O2. Oxidation of NH3 in trans-[OsII(tpy)(Cl)2(NH3)] gives trans-[OsVI(tpy)(Cl)2(N)]+ through a series of one-electron intermediates. It and related nitrido complexes undergo formal N- transfer analogous to O-atom transfer by RuIV=O2+. With secondary amines, the products are the hydrazido complexes, cis- and trans-[OsV(L3)(Cl)2(NNR2)]+ (L3=tpy or tpm and NR2-=morpholide, piperidide, or diethylamide). Reactions with aryl thiols and secondary phosphines give the analogous adducts cis- and trans-[OsIV(tpy)(Cl)2(NS(H)(C6H4Me))]+ and fac-[OsIV(Tp)(Cl)2(NP(H)(Et2))]. In dry CH3CN, all have an extensive multiple oxidation state chemistry based on couples from Os(VI/V) to Os(III/II). In acidic solution, the OsIV adducts are protonated, e.g., trans-[OsIV(tpy)(Cl)2(N(H)N(CH2)4O)]+, and undergo proton-coupled electron transfer to quinone to give OsV, e.g., trans-[OsV(tpy)(Cl)2(NN(CH2)4O)]+ and hydroquinone. These reactions occur with giant H/D kinetic isotope effects of up to 421 based on O-H, N-H, S-H, or P-H bonds. Reaction with azide ion has provided the first example of the terminal N4(2-) ligand in mer-[OsIV(bpy)(Cl)3(NalphaNbetaNgammaNdelta)]-. With CN-, the adduct mer-[OsIV(bpy)(Cl)3(NCN)]- has an extensive, reversible redox chemistry and undergoes NCN(2-) transfer to PPh3 and olefins. Coordination to Os also promotes ligand-based reactivity. The sulfoximido complex trans-[OsIV(tpy)(Cl)2(NS(O)-p-C6H4Me)] undergoes loss of O2 with added acid and O-atom transfer to trans-stilbene and PPh3. There is a reversible two-electron/two-proton, ligand-based acetonitrilo/imino couple in cis-[OsIV(tpy)(NCCH3)(Cl)(p-NSC6H4Me)]+. It undergoes reversible reactions with aldehydes and ketones to give the corresponding alcohols. 相似文献
15.
Kiriya D Chang HC Kamata A Kitagawa S 《Dalton transactions (Cambridge, England : 2003)》2006,(11):1377-1382
A novel series of valence tautomeric (VT) complexes, [Co(Cnbpy)(3,5-DTBQ)2] (Cnbpy = 4,4'-dialkyl-2,2'-bipyridine (alkyl = (C(n)H(2n+1)) where n = 0 (CoC0bpy), 1 (CoC1bpy), 5 (CoC5bpy), 9 (CoC9bpy) and 13 (CoC13bpy); 3,5-DTBQ = 3,5-di-tert-butylsemiquinonate or catecholate), including two previously reported complexes (CoC0bpy and CoC1bpy), were systematically prepared and their properties examined. Introduction of alkyl groups into VT chromophores leads to unexpected variations in the VT process, depending on the lengths of the alkyl chains. An even more interesting observation is that significant polytypic phase transitions with crystallographic symmetry changes accompanying the abrupt VT conversion are induced for the first time in CoC9bpy and CoC13bpy. 相似文献
16.
Gagliardo M Amijs CH Lutz M Spek AL Havenith RW Hartl F van Klink GP van Koten G 《Inorganic chemistry》2007,46(26):11133-11144
The dinuclear complex [(tpy)RuII(PCP-PCP)RuII(tpy)]Cl2 (bridging PCP-PCP = 3,3',5,5'-tetrakis(diphenylphosphinomethyl)biphenyl, [C6H2(CH2PPh2)2-3,5]22-) was prepared via a transcyclometalation reaction of the bis-pincer ligand [PC(H)P-PC(H)P] and the Ru(II) precursor [Ru(NCN)(tpy)]Cl (NCN = [C6H3(CH2NMe2)2-2,6]-) followed by a reaction with 2,2':6',2' '-terpyridine (tpy). Electrochemical and spectroscopic properties of [(tpy)RuII(PCP-PCP)RuII(tpy)]Cl2 are compared with those of the closely related [(tpy)RuII(NCN-NCN)RuII(tpy)](PF6)2 (NCN-NCN = [C6H2(CH2NMe2)2-3,5]22-) obtained by two-electron reduction of [(tpy)RuIII(NCN-NCN)RuIII(tpy)](PF6)4. The molecular structure of the latter complex has been determined by single-crystal X-ray structure determination. One-electron reduction of [(tpy)RuIII(NCN-NCN)RuIII(tpy)](PF6)4 and one-electron oxidation of [(tpy)RuII(PCP-PCP)RuII(tpy)]Cl2 yielded the mixed-valence species [(tpy)RuIII(NCN-NCN)RuII(tpy)]3+ and [(tpy)RuIII(PCP-PCP)RuII(tpy)]3+, respectively. The comproportionation equilibrium constants Kc (900 and 748 for [(tpy)RuIII(NCN-NCN)RuIII(tpy)]4+ and [(tpy)RuII(PCP-PCP)RuII(tpy)]2+, respectively) determined from cyclic voltammetric data reveal comparable stability of the [RuIII-RuII] state of both complexes. Spectroelectrochemical measurements and near-infrared (NIR) spectroscopy were employed to further characterize the different redox states with special focus on the mixed-valence species and their NIR bands. Analysis of these bands in the framework of Hush theory indicates that the mixed-valence complexes [(tpy)RuIII(PCP-PCP)RuII(tpy)]3+ and [(tpy)RuIII(NCN-NCN)RuII(tpy)]3+ belong to strongly coupled borderline Class II/Class III and intrinsically coupled Class III systems, respectively. Preliminary DFT calculations suggest that extensive delocalization of the spin density over the metal centers and the bridging ligand exists. TD-DFT calculations then suggested a substantial MLCT character of the NIR electronic transitions. The results obtained in this study point to a decreased metal-metal electronic interaction accommodated by the double-cyclometalated bis-pincer bridge when strong sigma-donor NMe2 groups are replaced by weak sigma-donor, pi-acceptor PPh2 groups. 相似文献
17.
Spillane CB Morgan JL Fletcher NC Collins JG Keene FR 《Dalton transactions (Cambridge, England : 2003)》2006,(25):3122-3133
The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents. 相似文献
18.
Scarborough CC Sproules S Doonan CJ Hagen KS Weyhermüller T Wieghardt K 《Inorganic chemistry》2012,51(12):6969-6982
The oxidation state of the chromium center in the following compounds has been probed using a combination of chromium K-edge X-ray absorption spectroscopy and density functional theory: [Cr(phen)(3)][PF(6)](2) (1), [Cr(phen)(3)][PF(6)](3) (2), [CrCl(2)((t)bpy)(2)] (3), [CrCl(2)(bpy)(2)]Cl(0.38)[PF(6)](0.62) (4), [Cr(TPP)(py)(2)] (5), [Cr((t)BuNC)(6)][PF(6)](2) (6), [CrCl(2)(dmpe)(2)] (7), and [Cr(Cp)(2)] (8), where phen is 1,10-phenanthroline, (t)bpy is 4,4'-di-tert-butyl-2,2'-bipyridine, and TPP(2-) is doubly deprotonated 5,10,15,20-tetraphenylporphyrin. The X-ray crystal structures of complexes 1, [Cr(phen)(3)][OTf](2) (1'), and 3 are reported. The X-ray absorption and computational data reveal that complexes 1-5 all contain a central Cr(III) ion (S(Cr) = (3)/(2)), whereas complexes 6-8 contain a central low-spin (S = 1) Cr(II) ion. Therefore, the electronic structures of 1-8 are best described as [Cr(III)(phen(?))(phen(0))(2)][PF(6)](2), [Cr(III)(phen(0))(3)][PF(6)](3), [Cr(III)Cl(2)((t)bpy(?))((t)bpy(0))], [Cr(III)Cl(2)(bpy(0))(2)]Cl(0.38)[PF(6)](0.62), [Cr(III)(TPP(3?-))(py)(2)], [Cr(II)((t)BuNC)(6)][PF(6)](2), [Cr(II)Cl(2)(dmpe)(2)], and [Cr(II)(Cp)(2)], respectively, where (L(0)) and (L(?))(-) (L = phen, (t)bpy, or bpy) are the diamagnetic neutral and one-electron-reduced radical monoanionic forms of L, and TPP(3?-) is the one-electron-reduced doublet form of diamagnetic TPP(2-). Following our previous results that have shown [Cr((t)bpy)(3)](2+) and [Cr(tpy)(2)](2+) (tpy = 2,2':6',2"-terpyridine) to contain a central Cr(III) ion, the current results further refine the scope of compounds that may be described as low-spin Cr(II) and reveal that this is a very rare oxidation state accessible only with ligands in the strong-field extreme of the spectrochemical series. 相似文献
19.
Thione-substituted derivatives of maltol are of interest in several applications of metal-based drugs. In order to investigate the effect of the oxygenation on such thione chelates, Ru complexes of 3-hydroxy-2-methyl-4-thiopyrone (thiomaltol or Htma) and 3-hydroxy-2-methyl-4H-thiopyran-4-thione (dithiomaltol or Httma), [Ru(bpy)2(tma)](+), 1, and [Ru(bpy) 2(ttma)] (+), 2, were synthesized as diamagnetic PF6(-) salts. Peroxidation of 2 unexpectedly generated products of C-H activation at its pendant methyl group; an air-stable aldehyde [Ru(bpy)2(ttma-aldehyde)](+), 4, was the major product. In addition, an intermediate oxidation product [Ru(bpy) 2(ttma-alcohol)](PF6), 3, was characterized. Both 3 and 4 are also formed by reaction of 2 with outersphere oxidants (e.g., Na2IrCl6) and by bulk electrolysis under anaerobic conditions. Similar oxidations of the analogous [Ru(bpy)2(ettma)](+), 2' , complex (3-hydroxy-2-ethyl-4H-thiopyran-4-thione; ethyl dithiomaltol or Hettma) formed the corresponding ketone, [Ru(bpy)2(ettma-ketone)](PF6), 4', by oxidation at the same position adjacent to the conjugated ring. The structures of the aldehyde 4 and starting materials 1 and 2 have been confirmed by X-ray crystallography, and all complexes have been characterized by UV-vis, (1)H NMR, and IR spectroscopies. Initial mechanistic investigations are discussed. 相似文献
20.
The crystal structure of [Mn(BDA)(bpy)2(H2O)](H2O)2 (1)(BDA=6,6′-dibromo-2,2′-dimethoxy-1,1′-binaphthylene-4,4′-disulfonate, bpy=2,2′-bipyridine) composes of a manganese center which is surrounded by two nitrogen atoms from 2,2′-bipyridine and four oxygen atoms from three water and sulfonate group of BDA that also participate in H-bonding interactions to form 3D network as well as some uncoordinated water. CCDC: 277922. 相似文献