Design of triple helix forming C-glycoside molecules

The modeling, synthesis, and characterization of oligomers containing 2-aminoquinazolin-5-yl 2'-deoxynucleotide residues are reported. The 2-aminoquinazoline residues sequence specifically bind via Hoogsteen base pairing as a third strand in the center of the major groove at T:A base pair Watson-Crick duplex sequences. Evidence for the formation of a sequence specific three-stranded structure is based on thermal denaturation UV-vis and fluorescence studies. The novel 2-aminoquinazoline C-nucleotide is a component of a system designed to overcome the homopurine requirement for triple helix structures.     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Binding of an acetic acid ligand to adenosine: a low-temperature NMR study

Binding of an acetic acid (HAc) ligand to adenosine (A) was studied by (1)H NMR spectroscopic techniques. Using a low-melting deuterated Freon mixture as solvent, liquid-state measurements could be performed in the slow exchange regime and allowed a detailed characterization of the formed associates. Thus, at 128 K, trimolecular complexes A.HAc(2) and A(2).HAc with both Watson-Crick and Hoogsteen sites of the central adenine base occupied coexist in various amounts depending on the adenosine:acetic acid molar ratio. Whereas the carboxylic acid OH proton is located closer to the acid for all hydrogen bonds formed, a more deshielded proton at the Watson-Crick site is evidence for a stronger hydrogen bond as compared to the Hoogsteen interaction. For the binding of acetic acid to an adenosine-thymidine base pair in either a Watson-Crick or a Hoogsteen configuration, hydrogen bonds to the available adenine binding site are strengthened as compared to the corresponding hydrogen bonds in the A.HAc(2) complex.     

Formation and stability of a Janus-Wedge type of DNA triplex

A new type of DNA targeting with the formation of a Janus-Wedge (J-W) triple helix is described. The "wedge" residue (W) attached to a PNA backbone is designed to insert itself into double-stranded DNA and base pair with both Watson-Crick faces. To study the stability of such an assembly, we have examined the formation of the J-W triplex with dC8 - T8 target sequence. The use of this target sequence permits the study of this new helix form without competing Watson-Crick interactions between the two target residues. Studies indicate that the W strand binds to both target strands, with defined polarity and a stability (-15.2 kcal/mol) that is roughly the sum of the two independent duplex interactions.     

Solution structure of a DNA duplex containing a guanine-difluorotoluene pair: a wobble pair without hydrogen bonding?

The incorporation of synthetic nucleoside analogues into DNA duplexes provides a unique opportunity to probe both structure and function of nucleic acids. We used 1H and 19F NMR and molecular dynamics calculations to determine the solution structures of two similar DNA decamer duplexes, one containing a central G-T mismatched or "wobble" base pair, and one in which the thymine in this base pair is replaced by difluorotoluene (a thymine isostere) creating a G-F pair. Here, we show that the non-hydrogen-bonding G-F pair stacks relatively well into the helix and that the distortions caused by each non-Watson-Crick G-T or G-F base pair are quite localized to a three base pair site around the mismatch. A detailed structural analysis reveals that the absence of hydrogen bonding introduces more dynamic motion into the G-F pair relative to G-T and permits the G-F pair to exhibit stacking and conformational features characteristic of both a Watson-Crick base pair (on the guanine containing strand) and a wobble base pair (on the strand containing the difluorotoluene). We used these results to posit a rationale for recognition and repair of mismatch sites in DNA.     

8-Oxoguanosine switches modulate the activity of alkylated siRNAs by controlling steric effects in the major versus minor grooves

Small interfering double-stranded RNAs have been synthesized bearing one or more base modifications at nucleotide positions 4, 11, and/or 16 in the guide strand. The chemically modified base is an N(2)-alkyl-8-oxo-7,8-dihydroguanine (alkyl = propyl, benzyl) that can alternatively pair in a Watson-Crick sense opposite cytosine (C) or as a Hoogsteen pair opposite adenine (A). Cellular delivery with C opposite led to effective targeting of A-containing but not C-containing mRNA sequences in a dual luciferase assay with RNA interference levels that were generally as good as or better than unmodified sequences. The higher activity is ascribed to an inhibitory effect of the alkyl group projecting into the minor groove of double-stranded RNA preventing off-target binding to proteins such as PKR (RNA-activated protein kinase).     

Role reversal in a supramolecular assembly: a chiral cyanine dye controls the helicity of a peptide-nucleic acid duplex

A new dicarbocyanine dye bearing branched, chiral N-alkyl substituents was synthesized and its ability to form helical aggregates on peptide nucleic acid (PNA) double-helical templates was studied. The dye aggregates less effectively than an analogous dye bearing linear, achiral substituents, presumably due to steric problems with packing the branched substituents compared with the linear substituents. When the PNA duplex has a left-handed helicity, addition of the achiral dye leads to formation of a left-handed dye aggregate. However, when the chiral dye aggregates in the presence of this duplex, a right-handed structure is formed, suggesting that the dye alters the helicity of the underlying template. When a racemic PNA duplex (i.e., equal amounts of right- and left-handed helices) is used, no chirality is observed for the dye aggregate formed by the achiral dye but a right-handed helical aggregate is once again formed by the chiral dye. These results indicate that chirality is transferred from the dye to the PNA, as opposed to other examples of polymer-templated dye aggregation where chirality is transferred from the template to the dye.     

Rebek imides and their adenine complexes: preferences for Hoogsteen binding in the solid state and in solution

Rebek imides (3), formed from Kemp's triacid, were developed in the mid-1980's as model receptors for adenine derivatives. We report here the first account of their hydrogen-bonding preferences upon binding 9-ethyladenine (1a) in the solid state. Structural analysis begins with simple imides 3a-e that form discrete dimers, while bis-imide 4 forms ribbon-like structures in the crystalline phase. The hydrogen-bonding interface within each of the representative assemblies features short intermolecular N(3)imide...O(8*)imide* distances (ca. 2.95 A), indicative of two-point hydrogen bonding. Imides 3f-h could be co-crystallized with 1a; single-crystal X-ray analysis of the resulting complexes reveals hydrogen-bonding geometries nearly identical to those observed in nucleobase complexes of adenine and pyrimidine derivatives. Imides 3f and 3g form 2:1 ternary assemblies with 1a; the complex of the former, (3f)2 x 1a, displays both Watson-Crick- and Hoogsteen-type hydrogen bonding, whereas the complex of the latter, (3g)2 x 1a, shows the Hoogsteen motif and imide hydrogen bonding to N(3) of the purine base (N(3)adenine...N(3')imide = 3.07(1) A). Imide 3h forms a 1:1 complex with 1a (3h x 1a x CHCl3) and displays Hoogsteen binding exclusively. All of the 3 x 1a assemblies show C(adenine)...O(imide) distances (3.38-3.75 A) that are consistent with C-H...O hydrogen bonding. Base-pairing preferences for the Rebek imides are further explored in solution by 1H NMR one-dimensional NOE experiments and by computational means; in all cases the Hoogsteen motif is modestly favored relative to its Watson-Crick counterpart.     

Janus-type AT nucleosides: synthesis, solid and solution state structures

Novel Janus-type nucleoside analogues (1a-d) were synthesized. Their pyrimido[4,5-d]pyrimidine base moiety has one face with a bidentate Watson-Crick donor-acceptor (DA) H-bond array of adenine and the other face with an acceptor-donor (AD) H-bond array of thymine. These nucleosides may self-associate through the self-complementary base pair. Indeed, in the solid state, compound 6d displayed a honeycomb-like supramolecular structure with tetrameric membered cavities formed through the combination of reverse Watson-Crick base pairs and aromatic stacking, in which the solvent molecules were accommodated. The result of temperature-dependent CD studies showed that the free nucleosides can form higher order chiral structures in aqueous solution.     

Gas-phase Watson-Crick and Hoogsteen isomers of the nucleobase mimic 9-methyladenine x 2-pyridone.

2-Pyridone (pyridin-2-one) is a mimic of the uracil and thymine nucleobases, with only one N--H and C==O group. It provides a single H-bonding site, compared to three for the canonical pyrimidine nucleobases. Employing the supersonically cooled 9-methyladenine2-pyridone (9MAd x 2PY) complex, which is the simplest base pair to mimic adenine-uracil or adenine-thymine, we show that its gas-phase UV spectrum consists of contributions from two isomers. Based on the H-bonding sites of 9-methyladenine, these are the Watson-Crick and Hoogsteen forms. Combining two-color two-photon ionisation (2C-R2PI), UV-UV depletion and laser-induced fluorescence spectroscopies allows separation of the two band systems, revealing characteristic intermolecular in-plane vibrations of the two isomers. The calculated S(0) and S(1) intermolecular frequencies are in good agreement with the experimental ones. Ab initio calculations predict the Watson-Crick isomer to be slightly more stable (D(0)=-16.0 kcal mol(-1)) than the Hoogsteen isomer (D(0)=-15.0 kcal mol(-1)). The calculated free energies Delta(f)G(0) of the Watson-Crick and Hoogsteen isomers agree qualitatively with the experimental isomer concentration ratio of 3:1.     

A Janus-Wedge DNA triplex with A-W1-T and G-W2-C base triplets

A new type of double-stranded DNA targeting format by formation of a Janus-Wedge (J-W) triple helix is described. The "wedge" residue W1 is used for A-T and T-A base pairs while W2 is used for G-C and C-G base pairs. Both wedge residues are attached to a PNA backbone that is designed to insert the probe strand into double-stranded DNA and base pair with both Watson-Crick faces. To study the stability of such an assembly, we have examined the formation of the J-W triplex with various sequences.     

Stabilization by extra-helical thymines of a DNA duplex with Hoogsteen base pairs

We present the crystal structure of the DNA duplex formed by d(ATATATCT). The crystals contain seven stacked antiparallel duplexes in the asymmetric unit with A.T Hoogsteen base pairs. The terminal CT sequences bend over so that the thymines enter the minor groove and form a hydrogen bond with thymine 2 of the complementary strand in the Hoogsteen duplex. Cytosines occupy extra-helical positions; they contribute to the crystal lattice through various kinds of interactions, including a unique CAA triplet. The presence of thymine in the minor groove apparently contributes to the stability of the DNA duplex in the Hoogsteen conformation. These observations open the way toward finding under what conditions the Hoogsteen duplex may be stabilized in vivo. The present crystal structure also confirms the tendency of A.T-rich oligonucleotides to crystallize as long helical stacks of duplexes.     

Coordination-driven inversion of handedness in ligand-modified PNA

Peptide nucleic acid (PNA) is a synthetic analogue of DNA, which has the same nucleobases as DNA but typically has a backbone based on aminoethyl glycine (Aeg). PNA forms duplexes by Watson Crick hybridization. The Aeg-based PNA duplexes adopt a chiral helical structure but do not have a preferred handedness because they do not contain a chiral center. An L-lysine situated at the C-end of one or both strands of a PNA duplex causes the duplex to preferably adopt a left-handed structure. We have introduced into the PNA duplexes both a C-terminal L-lysine and one or two PNA monomers that have a γ-(S)-methyl-aminoethyl glycine backbone, which is known to induce a preference for a right-handed structure. Indeed, we found that in these duplexes the γ-methyl monomer exerts the dominant chiral induction effect causing the duplexes to adopt a right-handed structure. The chiral PNA monomer had a 2,2':6',2'-terpyridine (Tpy) ligand instead of a nucleobase and PNA duplexes that contained one or two Tpys formed [Cu(Tpy)(2)](2+) complexes in the presence of Cu(2+). The CD spectroscopy studies showed that these metal-coordinated duplexes were right-handed due to the chiral induction effect exerted by the S-Tpy PNA monomer(s) except for the cases when the [Cu(Tpy)(2)](2+) complex was formed with Tpy ligands from two different PNA duplexes. In the latter case, the metal complex bridged the two PNA duplexes and the duplexes were left-handed. The results of this study show that the preferred handedness of a ligand-modified PNA can be switched as a consequence of metal coordination to the ligand. This finding could be used as a tool in the design of functional nucleic-acid based nanostructures.     

Site-selective RNA cleavage by DNA bearing a base pair-mimic nucleoside

We have synthesized the deoxyadenosine derivative tethering a phenyl group (X), which mimics the Watson-Crick A/T base pair. The RNA/DNA hybrid duplexes containing X in the middle of the DNA sequence showed a similar thermal stability regardless of the ribonucleotide species (A, G, C, or U) opposite to X, probably because of the phenyl group stacking inside of the duplex accompanied by the opposite ribonucleotide base flipped in an extrahelical position. The RNA strand hybridized with the DNA strand bearing X was cleaved on the 3'-side of the ribonucleotide opposite to X in the presence of MgCl2, and the RNA sequence to be cleaved was not restricted. The site-specific RNA hydrolysis suggests that the DNA strand bearing X has the advantage of the site-selective base flipping in the target sequence and the development of a "universal deoxyribozyme" to exclusively cleave a target RNA sequence.     

Role of electron-driven proton-transfer processes in the excited-state deactivation of the adenine-thymine base pair

Exploratory electronic structure calculations have been performed with the CC2 (simplified singles and doubles coupled-cluster) method for two conformers of the adenine (A)-thymine (T) base pair, with emphasis on excited-state proton-transfer reactions. The Watson-Crick conformer and the most stable (in the gas-phase) conformer of the A-T base pair have been considered. The equilibrium geometries of the ground state and of the lowest excited electronic states have been determined with the MP2 (second-order M?ller-Plesset) and CC2 methods, respectively. Vertical and adiabatic excitation energies, oscillator strengths, and dipole moments of the excited states are reported. Of particular relevance for the photochemistry of the A-T base pair are optically dark (1)pipi* states of charge-transfer character. Although rather high in energy at the ground-state equilibrium geometry, these states are substantially lowered in energy by the transfer of a proton, which thus neutralizes the charge separation. A remarkable difference of the energetics of the proton-transfer reaction is predicted for the two tautomers of A-T: in the Watson-Crick conformer, but not in the most stable conformer, a sequence of conical intersections connects the UV-absorbing (1)pipi* state in a barrierless manner with the electronic ground state. These conical intersections allow a very fast deactivation of the potentially reactive excited states in the Watson-Crick conformer. The results provide evidence that the specific hydrogen-bonding pattern of the Watson-Crick conformer endows this structure with a greatly enhanced photostability. This property of the Watson-Crick conformer of A-T may have been essential for the selection of this species as carrier of genetic information in early stages of the biological evolution.     

Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite

CEB25 is a human minisatellite locus, composed of slightly polymorphic 52-nucleotide (nt) tandem repeats. Genetically, most if not all individuals of the human population are heterozygous, carrying alleles ranging from 0.5 to 20 kb, maintained by mendelian inheritance but also subject to germline instability. To provide insights on the biological role of CEB25, we interrogated its structural features. We report the NMR structure of the G-quadruplex formed by the conserved 26-nt G-rich fragment of the CEB25 motif. In K(+) solution, this sequence forms a propeller-type parallel-stranded G-quadruplex involving a 9-nt central double-chain-reversal loop. This long loop is anchored to the 5'-end of the sequence by an A·T Watson-Crick base pair and a potential G·A noncanonical base pair. These base pairs contribute to the stability of the overall G-quadruplexstructure, as measured by an increase of about 17 kcal/mol in enthalpy or 6 °C in melting temperature. Further, we demonstrate that such a monomorphic structure is formed within longer sequence contexts folding into a pearl-necklace structure.     

Theoretical studies of d(A:T)-based parallel-stranded DNA duplexes.

Poly d(A:T) parallel-stranded DNA duplexes based on the Hoogsteen and reverse Watson-Crick hydrogen bond pairing are studied by means of extensive molecular dynamics (MD) simulations and molecular mechanics coupled to Poisson-Boltzmann (MM-PB/SA) calculations. The structural, flexibility, and reactivity characteristics of Hoogsteen and reverse Watson-Crick parallel duplexes are described from the analysis of the trajectories. Theoretical calculations show that the two parallel duplexes are less stable than the antiparallel Watson-Crick duplex. The difference in stability between antiparallel and parallel duplexes increases steadily as the length of the duplex increases. The reverse Watson-Crick arrangement is slightly more stable than the Hoogsteen duplex, the difference being also increased linearly with the length of the duplex. A subtle balance of intramolecular and solvation terms is responsible for the preference of a given helical structure.     

An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing

Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ～ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.     

Four-stranded DNA structure stabilized by a novel G:C:A:T tetrad

The solution structure of a cyclic oligonucleotide d has been determined by two-dimensional NMR spectroscopy and restrained molecular dynamics. Under the appropriate experimental conditions, this molecule self-associates, forming a symmetric dimer stabilized by four intermolecular Watson-Crick base pairs. The resulting four-stranded structure consists of two G:C:A:T tetrads, formed by facing the minor groove side of the Watson-Crick base-pairs. Most probably, the association of the base-pairs is stabilized by coordinating a Na(+) cation. This is the first time that this novel G:C:A:T tetrad has been found in an oligonucleotide structure. This observation increases considerably the number of sequences that may adopt a four-stranded architecture. Overall, the three-dimensional structure is similar to those observed previously in other quadruplexes formed by minor groove alignment of Watson-Crick base pairs. This resemblance strongly suggests that we may be observing a general motif for DNA-DNA recognition.