Zinc(II) complexes of ubiquitin: speciation, affinity and binding features

Intraneuronal inclusions consisting of hypermetallated, (poly-)ubiquitinated proteins are a hallmark of neurodegeneration. To highlight the possible role played by metal ions in the dysfunction of the ubiquitin-proteasome system, here we report on zinc(II)/ubiquitin binding in terms of affinity constants, speciation, preferential binding sites and effects on protein stability and self-assembly. Potentiometric titrations allowed us to establish that at neutral pH only two species, ZnUb and Zn(2)Ub, are present in solution, in line with ESI-MS data. A change in the diffusion coefficient of ubiquitin was observed by NMR DOSY experiments after addition of Zn(II) ions, and thus indicates metal-promoted formation of protein assemblies. Analysis of (1)H, (15)N, (13)Cα and (13)CO chemical-shift perturbation after equimolar addition of Zn(II) ions to ubiquitin outlined two different metal-binding modes. The first involves a dynamic equilibrium in which zinc(II) is shared between a region including Met1, Gln2, Ile3, Phe4, Thr12, Leu15, Glu16, Val17, Glu18, Ile61 and Gln62 residues, which represent a site already described for copper binding, and a domain comprising Ile23, Glu24, Lys27, Ala28, Gln49, Glu51, Asp52, Arg54 and Thr55 residues. A second looser binding mode is centred on His68. Differential scanning calorimetry evidenced that addition of increasing amounts of Zn(II) ions does not affect protein thermal stability; rather it influences the shape of thermograms because of the increased propensity of ubiquitin to self-associate. The results presented here indicate that Zn(II) ions may interact with specific regions of ubiquitin and promote protein-protein contacts.     

Role of cofactors in folding of the blue-copper protein azurin

Many proteins in living cells coordinate cofactors, such as metal ions, to attain their activity. Since the cofactors in such cases often can interact with their corresponding unfolded polypeptides in vitro, it is important to unravel how cofactors modulate protein folding. In this review, I will discuss the role of cofactors in folding of the blue-copper protein Pseudomonas aeruginosa azurin. In the case of both copper (Cu(II) and Cu(I)) and zinc (Zn(II)), the metal can bind to unfolded azurin. The residues involved in copper (Cu(II) and Cu(I)) coordination in the unfolded state have been identified as Cys112, His117, and Met121. The affinities of Cu(II), Cu(I), and Zn(II) are all higher for the folded than for the unfolded azurin polypeptide, resulting in metal stabilization of the native state as compared to the stability of apo-azurin. Cu(II), Zn(II), and several apo forms of azurin all fold in two-state kinetic reactions with roughly identical polypeptide-folding speeds. This suggests that the native-state beta-barrel topology, not cofactor interactions or thermodynamic stability, determines azurin's folding barrier. Nonetheless, copper binds much more rapidly (i.e., 4 orders of magnitude) to unfolded azurin than to folded azurin. Therefore, the fastest route to functional azurin is through copper binding before polypeptide folding; this sequence of events may be the relevant biological pathway.     

The Biological Activity of Zeise’s Salt and its Derivatives

With the aim to design new biologically active bioinorganic drugs of aspirin, whose mode of action is based on the inhibition of the cyclooxygenase(COX) enzymes, derivatives of Zeise’s salt were synthesized in this structure–activity relationship study. Surprisingly, not only these Zeise–aspirin compounds but also Zeise’s salt itself showed high inhibitory potency against COX enzymes in in vitro assays. In contrast, potassium tetrachloroplatinate and cisplatin did not influence the enzyme activity at equimolar concentrations. It was demonstrated by LC‐ESI tandem‐mass spectrometry that Zeise’s salt platinates the essential amino acids Tyr385 (active site of the enzyme) and Ser516 (will be acetylated by aspirin) of COX‐1, thereby strongly impairing the function of the enzyme. This finding demonstrates for the first time that Zeise’s salt is pharmacologically active and is a potent enzyme inhibitor.     

Use of tetracyanoplatinate (ii) for the luminescent detection of metalions

The tetracyanoplatinate(II) (TCP) ion forms insoluble fluorescent compounds with many metal ions. This property has not hitherto been exploited for analytical use. The soluble sodium TCP salt has been applied as a reagent for metal ion detection. Fluorescent precipitates useful for detection of the metal ions were obtained with Y(III), Zr(IV), Ag(I), Zn(II), Cd(II), Hg(I), Hg(II), A1(III), Pb(II), La(III) and Th(IV). Limits of detection ranged from 5 to 200 ppm. With ammonium acetate as a masking agent, selective detection of 10 ppm of silver was achieved in the presence of the other metal ions. As little as 20 ppm of zirconium can be detected in the presence of hafnium, which yields a non-fluorescent precipitate.     

Spacer layer screening effect: a novel fluorescent film sensor for organic copper(II) salts

A fluorescent film sensor was prepared by chemical assembly of pyrene on a glass plate surface via a long flexible spacer. It was found that the film is highly selective for some organic Cu2+ salts, such as copper acetate and copper propionate. The presence of inorganic Cu2+ salts and other metal(II) acetates, including Ni2+, Co2+, Pb2+, Cd2+, Zn2+, etc., had little effect upon the sensing behavior of the film for copper acetate or copper propionate. The observation was explained by employing a proposed "two-dimensional solution" model. The quenching by copper acetate of the emission of the film is static in nature due to complexation of the spacers to the metal ions. Furthermore, the response of the film sensor to copper acetate is fully reversible. To the best of our knowledge, this film sensor may be the first one that can differentiate greasy copper salts from inorganic copper salts.     

Electrochemical approach to monitoring metal exchange reaction of acetylacetonate complexes with cadmium, copper and zinc ions

Metal exchange reactions of acetylacetonate complexes with Cd(II), Cu(II) and Zn(II) ions were investigated by using cadmium and copper ion selective electrodes. Changes in the electrode potential and pH of the solutions were monitored upon adding the pertinent metal Zn(II) of the acetylacetonate (AA) complexes. In the reverse system in which a stable Cu-AA complex exists in the solution prior to adding a secondary metal ion (Cd(II) or Zn(II)), no Cu(II) was replaced by either ion. In the systems containing Cd(II) and Zn(II) as a complexed form with AA or as free ions, the exchange reactions were not explained by considering the equilibrium stability constants of the Cd-AA and Zn-AA complexes.     

Structural chemistry of a green fluorescent protein Zn biosensor

We designed a green fluorescent protein mutant (BFPms1) that preferentially binds Zn(II) (enhancing fluorescence intensity) and Cu(II) (quenching fluorescence) directly to a chromophore ligand that resembles a dipyrrole unit of a porphyrin. Crystallographic structure determination of apo, Zn(II)-bound, and Cu(II)-bound BFPms1 to better than 1.5 A resolution allowed us to refine metal centers without geometric restraints, to calculate experimental standard uncertainty errors for bond lengths and angles, and to model thermal displacement parameters anisotropically. The BFPms1 Zn(II) site (KD = 50 muM) displays distorted trigonal bipyrimidal geometry, with Zn(II) binding to Glu222, to a water molecule, and tridentate to the chromophore ligand. In contrast, the BFPms1 Cu(II) site (KD = 24 muM) exhibits square planar geometry similar to metalated porphyrins, with Cu(II) binding to the chromophore chelate and Glu222. The apo structure reveals a large electropositive region near the designed metal insertion channel, suggesting a basis for the measured metal cation binding kinetics. The preorganized tridentate ligand is accommodated in both coordination geometries by a 0.4 A difference between the Zn and Cu positions and by distinct rearrangements of Glu222. The highly accurate metal ligand bond lengths reveal different protonation states for the same oxygen bound to Zn vs Cu, with implications for the observed metal ion specificity. Crystallographic anisotropic thermal factor analysis validates metal ion rigidification of the chromophore in enhancement of fluorescence intensity upon Zn(II) binding. Thus, our high-resolution structures reveal how structure-based design has effectively linked selective metal binding to changes in fluorescent properties. Furthermore, this protein Zn(II) biosensor provides a prototype suitable for further optimization by directed evolution to generate metalloprotein variants with desirable physical or biochemical properties.     

The Chaperone‐like Activity and Structure of Mutant H119G of Rat Lens αB‐crystallin: A Study of Divalent Metal Ion Binding Site

The molecular chaperone αB‐crystallin, the major player in maintaining the transparency of the eye lens, preventing the aggregation of stress‐damaged and aging lens proteins from aggregation. In nonlenticular cells, it is involved in various neurological diseases, diabetes, and cancer. The role of some metal ions in the αB‐crystallin biology has been reported. Theoretical calculations have proposed that the coordination sites involving His101, His119, Lys121, His18 and Glu99 of human αB‐crystallin were the binding sites for divalent metal ions. Our previous mutagenesis study suggested that His18 rat lens αB‐crystallin is a crucial binding site for Cu(II) and Zn(II) in terms of chaperone‐like activity and structure. In this study mutant H119G of rat lens αB‐crystalin was cloned and expressed to investigate whether His119 is the coordination binding site. Copper and zinc at 1 mM concentration significantly increase the chaperone‐like activity in wild type αB‐crystalin, whereas zinc, copper and magnesium at 1 mM reduced the activity of H119G significantly. The results from chaperone‐like activity, ANS fluorescence measurement and Far‐and Near‐UV CD studies suggest that the replacement of His119 with Glycine resulted in a conformational and minor environmental changes that decrease chaperone‐like activity in the presence of divalent ions suggested that His119 was a crucial binding site for Cu(II) and Zn(II), which was similar to our previous study results of His18. Both results together suggest that His18 and His119 coordinates each other for the binding site of Cu(II) and Zn(II) in terms of improving the chaperone‐like activity and stability of crystallin/metal ion complex.     

Structure and dynamics of metallomacrocycles: recognition of zinc xylyl-bicyclam by an HIV coreceptor

As platforms for the design of metal-based therapeutic and diagnostic agents, macrocycles are rigid enough to provide strong metal binding sites and orient functional groups stereoselectively, yet flexible enough to accommodate structural changes required for induced-fit recognition of biological targets. We consider the recognition of the Zn(II) complex of the bis-tetraazamacrocycle xylyl-bicyclam, a potent anti-HIV agent, by the coreceptor CXCR4, a G-protein-coupled receptor used by HIV for membrane fusion and cell entry. NMR studies show that the macrocycles of Zn(II)(2)-xylyl-bicyclam perchlorate exist in aqueous solution as two major configurations, trans-I (nitrogen chirality R,S,R,S), and trans-III (S,S,R,R). Acetate addition induced a major structural change. X-ray crystallography shows that the acetate complex contains the unusual cis-V cyclam configuration (R,R,R,R and folded) with bidentate coordination of acetate to Zn(II) plus second-coordination-sphere double H-bond formation between diagonal NH protons on the opposite cyclam face and acetate carboxylate oxygens. Detailed 1D and 2D NMR studies show that the major configuration of Zn(II)(2)-xylyl-bicyclam acetate in aqueous solution is cis-V/trans-I. Molecular modeling shows that an analogous cis-V site can be formed when Zn(II)(2)-xylyl-bicyclam binds to CXCR4, involving the carboxylate groups of Asp262 (Zn(II) coordination) and Glu288 (double H-bonding). The second cyclam can adopt the trans-I (or trans-III) configuration with Zn(II) binding to Asp171. These interactions are consistent with the known structure-activity relationships for bicyclam anti-HIV activity and receptor mutation. Consideration of the anti-HIV activity of xylyl-bicyclam complexes of other metal ions suggests that affinity for carboxylates, configurational flexibility, and kinetic factors may all play roles in receptor recognition. For example, Pd(II) cyclam complexes interact only weakly with axial ligands and are inflexible and inactive, whereas Co(III) cyclams bind carboxylates strongly, are configurationally flexible, and yet have low activity. Our findings should aid the design of new generations of active macrocycles including highly specific chemokine receptor antagonists.     

Platinum nanoparticles generated in functionality-enhanced reaction media based on polyoctadecylsiloxane with long-chain functional modifiers

Functionality-enhanced nanostructured matrices generated by intercalating polyoctadecylsiloxane (PODS) with octadecene (ODC) or octadecylamine (ODA) are employed as reaction media in which to grow Pt nanoparticles. Small-angle X-ray scattering (SAXS) signatures confirm that the amphiphilic PODS matrix orders into lamellae with a periodicity (d) of 5.24 nm, which corresponds to the siloxy bilayer and a double layer of alkyl tails. The regular packing of the hydrophobic tails becomes distorted upon introduction of ODC or ODA. Incorporation of K[(C2H4)PtCl3].H2O (a Zeise salt) into the PODS/ODC matrix, followed by reduction of the Pt ions by NaBH4 or H2, results in the localization of Pt compounds and nanoparticles along the siloxy bilayers, which remain dimensionally unchanged. Electron density profiles deduced from PODS/ODA, however, provide evidence for considerable structural reorganization upon metalation with H2PtCl6.6H2O. In this case, the siloxy bilayers broaden due to the presence of PtCl62- ions, and the hydrophobic layers become distorted due to the formation of (PtCl62-)(ODAH+)2 complexes. Subsequent reduction by NaBH4 restores the inherent PODS organization, while H2 reduction partially preserves the distorted matrix, indicating that some Pt nanoparticles form in close proximity to the siloxy bilayer. Transmission electron microscopy reveals that relatively monodisperse Pt nanoparticles measuring approximately 1 nm in diameter are located along the siloxy bilayers, whereas anomalous SAXS further indicates that nanoparticles form aggregates of comparable size to d within the PODS double layers.     

Relation between the crystal structures of some salts of the type Me(OCOCH3)2 · nH2O and their ability to form mixed crystals or double salts (Me2+ = Mg,Ca, Mn,Co, Ni,Cu, Zn,Cd)

An attempt is made to find the relation between the crystal structures of some salts of the type Me(OCOCH₃)₂ · nH₂O (Me²⁺ = Mg, Ca, Mn, Co, Ni, Cu, Zn, Cd) and their ability to form mixed crystals or double salts by taking into account the difference in the ground-state configurations of the metal (II) ions. Such a treatment is based on the theoretical argument that the formation of isomorphous and isodimorphous mixed crystals occurs when the admixed ion may assume the coordination environment of the substituted ion in the crystal structure of the host salt. Double salts are formed mainly between the acetates of the d⁵, d¹⁰ and p⁶ metal ions, i.e., for ions that allow strong angular deformations of the coordination polyhedra or when at least one of the metal ions meets this condition so that acetate bridge bonding may occur.     

Dynamics of Zn(II) binding as a key feature in the formation of amyloid fibrils by Aβ11-28

Supramolecular assembly of peptides and proteins into amyloid fibrils is of multifold interest, going from materials science to physiopathology. The binding of metal ions to amyloidogenic peptides is associated with several amyloid diseases, and amyloids with incorporated metal ions are of interest in nanotechnology. Understanding the mechanisms of amyloid formation and the role of metal ions can improve strategies toward the prevention of this process and enable potential applications in nanotechnology. Here, studies on Zn(II) binding to the amyloidogenic peptide Aβ11-28 are reported. Zn(II) modulates the Aβ11-28 aggregation, in terms of kinetics and fibril structures. Structural studies suggest that Aβ11-28 binds Zn(II) by amino acid residues Glu11 and His14 and that Zn(II) is rapidly exchanged between peptides. Structural and aggregation data indicate that Zn(II) binding induces the formation of the dimeric Zn(II)(1)(Aβ11-28)(2) species, which is the building block of fibrillar aggregates and explains why Zn(II) binding accelerates Aβ11-28 aggregation. Moreover, transient Zn(II) binding, even briefly, was enough to promote fibril formation, but the final structure resembled that of apo-Aβ11-28 amyloids. Also, seeding experiments, i.e., the addition of fibrillar Zn(II)(1)(Aβ11-28)(2) to the apo-Aβ11-28 peptide, induced aggregation but not propagation of the Zn(II)(1)(Aβ11-28)(2)-type fibrils. This can be explained by the dynamic Zn(II) binding between soluble and aggregated Aβ11-28. As a consequence, dynamic Zn(II) binding has a strong impact on the aggregation behavior of the Aβ11-28 peptide and might be a relevant and so far little regarded parameter in other systems of metal ions and amyloidogenic peptides.     

Internal versus terminal metalation of double-helical oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.     

EPR studies of Cu2+ in tetraaqua-di(nicotinamide) Zn(II)-saccharinate single crystals

Electron paramagnetic resonance (EPR) studies of copper ions, Cu(II), as paramagnetic impurity in tetraaqua-di(nicotinamide) Zn(II)-saccharinates single crystals [Zn(nic)2(H2O)4](sac)2, have been investigated at ambient temperature. The detailed EPR analysis shows the only one site and the copper ion entered the lattice substitutionally in place of Zn(II). The spin-Hamiltonian parameters were obtained from the single crystal EPR analysis. By using the EPR data, molecular bonding coefficient and the Fermi contact interaction terms have been evaluated. Superhyperfine splittings were observed.     

Ratiometric fluorescent sensor proteins with subnanomolar affinity for Zn(II) based on copper chaperone domains

The ability to image the concentration of transition metals in living cells in real time is important for further understanding of transition metal homeostasis and its involvement in diseases. The goal of this study was to develop a genetically encoded FRET-based sensor for copper(I) based on the copper-induced dimerization of two copper binding domains involved in human copper homeostasis, Atox1 and the fourth domain of ATP7B (WD4). A sensor has been constructed by linking these copper binding domains to donor and acceptor fluorescent protein domains. Energy transfer is observed in the presence of Cu(I), but the Cu(I)-bridged complex is easily disrupted by low molecular weight thiols such as DTT and glutathione. To our surprise, energy transfer is also observed in the presence of very low concentrations of Zn(II) (10(-)(10) M), even in the presence of DTT. Zn(II) is able to form a stable complex by binding to the cysteines present in the conserved MXCXXC motif of the two copper binding domains. Co(II), Cd(II), and Pb(II) also induce an increase in FRET, but other, physiologically relevant metals are not able to mediate an interaction. The Zn(II) binding properties have been tuned by mutation of the copper-binding motif to the zinc-binding consensus sequence MDCXXC found in the zinc transporter ZntA. The present system allows the molecular mechanism of copper and zinc homeostasis to be studied under carefully controlled conditions in solution. It also provides an attractive platform for the further development of genetically encoded FRET-based sensors for Zn(II) and other transition metal ions.     

Copper nanoparticles synthesized by the polyol method and their oxidation in polar dispersion media. The influence of chloride and acetate ions

Copper nanoparticles have been synthesized from Cu(2+) acetate in the medium of dimethylformamide by the polyol method using hydrazine as a reductant and poly(vinylpyrrolidone) as a stabilizer. Optical spectroscopy has been employed to study the influence of chloride and acetate ions on the oxidation of copper nanoparticles by atmospheric oxygen in aqueous and dimethylformamide media, respectively. It has been established that the presence of ions of one of the aforementioned types in a colloidal solution significantly accelerates the oxidation of metal nanoparticles. In the case of acetate ions, copper oxide particles rapidly dissolve to form the corresponding salt. It has been shown that Cu nanoparticles can be repeatedly formed in such a solution by the addition of hydrazine.     

Mn(II) and Zn(II) interactions with peptide fragments from Parkinson's disease genes

Two peptide sequences from PARK9 Parkinson's disease gene, ProAspGluLysHisGluLeu, (P(1)D(2)E(3)K(4)H(5)E(6)L(7)) (1) and PheCysGlyAspGlyAlaAsnAspCysGly (F(1)C(2)G(3)D(4)G(5)A(6)N(7)D(8)C(9)G(10)) (2) were tested for Mn(II), Zn(II) and Ca(II) binding. The fragments are located from residues 1165 to 1171 and 1184 to 1193 in the PARK9 encoded protein. This protein can protect cells from poisoning of manganese, which is an environmental risk factor for a Parkinson's disease-like syndrome. Mono- and bi-dimensional NMR spectroscopy has been used to understand the details of metal binding sites at different pH values and at different ligand to metal molar ratios. Mn(II) and Zn(II) coordination with peptide (1) involves imidazole N(ε) or N(δ) of His(5) and carboxyl γ-O of Asp(2), Glu(3) and Glu(6) residues. Six donor atoms participate in Mn(II) binding resulting in a distorted octahedral geometry, possibly involving bidentate interaction of carboxyl groups; four donor atoms participate in Zn(II) binding resulting in a tetracoordinate geometry. Mn(II) and Zn(II) coordination involves the two cysteine residues with peptide (2); Mn(II) accepts additional ligand bonds from the carboxyl γ-O of Asp(4) and Asp(8) to complete the coordination sphere; the unoccupied sites may contain solvent molecules. The failure of Ca(II) ions to bind to either peptide (1) or (2) appears to result, under our conditions, from the absence of chelating properties in the chosen fragments.     

Carboxylate ion dependency in the Cu(II) catalysed asymmetric Henry reaction: Structural characterisation of a tridentate Schiff base complex containing a coordinated carboxylic acid

Six tridentate Schiff base ligands containing tertiary butyl or benzyl substituents were prepared from chiral amino alcohols and salicylaldehyde derivatives. The ligands were employed as catalysts for the Cu(II) catalysed asymmetric Henry reaction. It was discovered that when different carboxylate salts were used instead of copper acetate as the Cu(II) salt, significant changes in the enantioselectivity of the reactions were observed. Addition of Cu(OAc)₂ to the ligand prepared from salicylaldehyde and α,α‐diphenyl‐tert ‐leucinol resulted in the formation of dark green crystals. X‐ray structural analysis of these crystals showed that a square planar monomeric complex had been formed rather than the expected dimer. In the structure, the copper(II) centre is bonded to the tridentate ONO ligand and an acetate ion. There is a strong hydrogen bond between the protonated alcoholic oxygen of the Schiff base ligand and the uncoordinated acetate oxygen atom. These results, taken together, indicate that the carboxylate anion may be an important part of the active intermediate when this type of copper complex is used as a catalyst in the asymmetric Henry reaction.     

Recovery of heavy metal ions from aqueous solutions using modified organosilicas

Sorption of Cu(II), Pb(II), Cd(II), and Zn(II) from aqueous solutions on two-component organosilicas was studied as influenced by sorbent composition, contact time, ratio of solid and liquid phases, solution pH, nature and concentration of heavy metal ions, and content of modifying agent. The degrees of sorption of these metal ions from aqueous solutions using organosilicas modified with aluminum(III) added into the siloxane matrix or with copper(II) grafted to the sorbent surface layer were compared.