Exploring structural and conformational behaviour of cyclophanes incorporating imidazole-2-thiones

New cyclophanes containing two imidazole-2-thione moieties linked by two xylylene groups have been synthesized by the reaction of imidazolium-linked cyclophanes with sulfur in the presence of K₂CO₃. The conformational behaviour of the new cyclophanes was explored by NMR spectroscopy and X-ray diffraction studies. In cyclophanes containing o-xylylene or 2,4,6-trimethyl-m-xylylene linking groups, the imidazole-2-thione groups were mutually syn in both the solid state and in solution, the cyclophanes adopting a conformation reminiscent of the cone conformation of calix[4]arenes. Cyclophanes containing p-xylylene or m-xylylene linking groups exhibited two conformations in solution, one in which the imidazole-2-thione groups are mutually syn, the other in which they are mutually anti, and these conformations did not interconvert on the NMR timescale. Both conformations co-crystallised in the m-xylylene linked cyclophane, while for the p-xylylene-linked cyclophane the anti conformation crystallised separately.     

Molecular Pacman: folding, inclusion, and X-ray structures of tri- and tetraamino piperazine cyclophanes

Reaction of piperazine and 1,3-bis(bromomethyl)-2-nitrobenzene under high-dilution conditions yields cyclic trimeric trinitro, tetrameric tetranitro, and pentameric pentanitro piperazine cyclophanes. Reduction of the nitro groups with SnCl(2) under acidic conditions produces the corresponding triamino and tetraamino piperazine cyclophanes. The solution studies of both nitro and amino piperazine cyclophanes at 30 degrees C by (1)H NMR spectroscopy shows symmetrical structures owing to the fast conformational exchange, whereas the low temperature studies of the tetraamino piperazine cyclophane reveals interesting dynamic behavior that indicates additional intramolecular interactions. Careful crystallizations of the trimeric trinitro and triamino and the tetrameric tetraamino cyclophanes resulted in crystals suitable for X-ray diffraction studies. In the crystalline state the amino-functionalized cyclophanes manifest an extraordinary circular intramolecular hydrogen-bonding network that leads to a fixed 3D structure. Hydrogen bonding in the triamino trimer leads to orientation of all three of the amino groups on the same side of the macrocycle, namely, the rcc conformation, whereas the tetraamino tetramer folds into a more compact shell-like conformation. During the crystallization process one acetonitrile guest is enclosed into the cavity of the tetraamino cyclophane, which gives a crystalline inclusion complex with remarkable resemblance to the famous Pacman motif. The folding, which mimics the behavior of some cyclic peptides and pyrroles, is induced by intramolecular hydrogen bonding from the amino groups to the tertiary amine groups of the piperazines. The cavity of the tetraamino tetramer is markedly smaller than in the corresponding, but nonfolded, tetranitro tetramer and the guest/host volume ratio (packing coefficient) for the acetonitrile and the cavity is approximately 50 %, which indicates a good size match for acetonitrile inclusion.     

Azolium-linked cyclophanes: a comprehensive examination of conformations by 1H NMR spectroscopy and structural studies

The synthesis and characterization of a series of azolium-linked cyclophanes are reported. The cyclophanes consist of two azolium groups (17 examples) or three imidazolium groups (1 example) linked to two benzenoid units (benzene, naphthalene, p-xylene, mesitylene, 1,2,3,4- and 1,2,4,5-tetramethylbenzene, 2,6-pyridine, and p-tert-butylphenol) via methylene groups. Cyclophanes containing ortho-, meta-, and para-substitution patterns in the benzenoid units were examined. The conformations of the cyclophanes were examined in solution by variable-temperature NMR studies and in the solid state by crystallographic studies. The p-cyclophanes and mesitylene-based m- and o/m-cyclophanes are rigid on the NMR time scale, as indicated by sharp (1)H NMR spectra at all accessible temperatures. The non-mesitylene-based m-cyclophanes and the o-cyclophanes are fluxional on the NMR time scale at high temperatures, but in most cases, specific conformations can be "frozen out" at low temperatures. Many structures deduced from solution studies were consistent with those in the solid state.     

Tridentate, anionic tethered N-heterocyclic carbene of Pd(II) complexes

The synthesis of a series of azolium salts such as azolium iodides and chlorides having both N-anionic functional group and N-alkyl group have been developed. Reaction of azolium iodides or chlorides with Ag₂O gave the corresponding NHC-Ag complexes. It was found that the resulting NHC-Ag complexes derived from azolium iodides or chlorides differ in their physical properties. The azolium chlorides as well as azolium iodides were successfully converted into the NHC-Ag complexes, which subsequently reacted with PdCl₂(CH₃CN)₂ to give the anionic amidate/NHC-Pd complexes. Thus, a variety of the NHC-Pd complexes could be obtained from benzimidazolium and imidazolium salts.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Comparison of the ATP binding sites of protein kinases using conformationally diverse bisindolylmaleimides

The conformation of a bisindolylmaleimide may be controlled by the size of a macrocyclic ring in which it is constrained. A range of techniques were used to demonstrate that the tether controls both the ratio of the two limiting conformers (syn and anti) in solution and the extent of conjugation between the maleimide and indole rings. Screening the conformationally diverse bisindolylmaleimides against a panel of protein kinases allowed their ATP binding sites to be compared using a chemical approach which, like sequence alignment, does not require detailed structural information. This approach lead to the conclusion that several AGC group protein kinases (including PKCalpha, PKCbeta, MSK1, p70 S6K, PDK-1, and MAPKAP-K1alpha) may be best inhibited by bisindolylmaleimides which adopt a compressed approximately C2-symmetric anti conformation; in constrast, GSK3beta may be best inhibited by bisindolylmaleimides whose ground state is a distorted syn conformation. It is concluded that PDK-1, whose structure has been determined by X-ray crystallography, and its mutants, may serve as particularly useful surrogates for the study of PKC inhibitors.     

Dinuclear N-heterocyclic carbene complexes of silver(I), derived from imidazolium-linked cyclophanes

The synthesis of four new silver complexes of bidentate N-heterocyclic carbenes, derived from imidazolium-linked cyclophanes, has been achieved via a simple complexation reaction of the imidazolium-linked cyclophanes with the basic metal source Ag(2)O. The cyclophane structures contain two imidazolyl links between ortho-, meta- and mixed ortho/meta-substituted aromatic rings. The new silver carbene systems are thermally stable and have been characterised by NMR spectroscopy and X-ray crystallography. Three of the complexes have a dimeric structure of the form [L(2)Ag(2)](2+) in the solid state that is rigid on the NMR timescale in solution. The fourth complex has a neutral structure of the form [L(AgBr)(2)], the NMR studies suggesting some lability of the L-Ag bonding in solution.     

Structural characterization of anti- and syn-allyltricarbonyliron bromide: rotational spectra, quadrupole coupling, and density functional calculations

Rotational transitions for two distinct structural isomers of allyltricarbonyliron bromide have been clearly observed in the cold molecular beam of a pulsed-beam Fourier transform microwave spectrometer. Rotational transitions exhibiting quadrupole splitting patterns for each isomer were measured for the 79Br and 81Br isotopomers. Both isomers are accidental near-prolate symmetric tops. The measured rotational constants for the 79Br isotopomer are A(anti) = 920.6148(2) MHz, B(anti) = 582.8866(12) MHz, C(anti) = 581.3027(12) MHz, A(syn) = 919.5055(1) MHz, B(syn) = 584.1865(1) MHz, and C(syn) = 581.6392(1) MHz. Analysis of the isotopic substitution data and possible transition assignments indicates that these molecules have Cs symmetry. Both isomers are found to have a dipole component along the a axis. However, the anti isomer has a "c" type dipole component, whereas a "b" dipole component is found for the syn isomer. It was found necessary to carefully analyze both rotational constants and the quadrupole coupling data in order to determine the correct assignment of dipole moment components for each isomer. This change in dipole assignments implies that there is a switch of inertial axes upon isomerization resulting from a subtle shift of the allyl center of mass coordinates, upon reorientation of the allyl ligand. The X-ray and DFT calculated structures for the anti isomer are in excellent agreement with the present data. No previous structural data for the syn isomer were available, and the present analysis strongly supports the expected conformation.     

Stereoselective dialkylation of the proximal hydroxy groups of calix- and thiacalix[4]arenes

Treatment of p-tert-butylcalix[4]arene (C1) and its sulfur-bridged analog T1 with 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane in the presence of imidazole gives proximally O,O'-disiloxane-1,3-diyl-bridged calixarenes C2 and T2 in excellent yields, respectively. Subsequent base-catalyzed etherification of the remaining hydroxy groups with alkyl halides gives syn- and anti-O',O'-dialkylated products, the stereoselectivity of which varies depending on the nature of the macrocycle, as well as the metal cation of the base employed. Thus, conventional calixarene C2 preferentially affords syn compounds of 1,2-alternate conformation (C3) with the aid of tert-BuOK and K(2)CO(3) and anti counterparts of partial-cone conformation (C4) with Cs(2)CO(3). On the other hand, thiacalixarene T2 affords syn compounds of 1,2-alternate conformation (T3) with any of the bases. The disiloxanediyl bridge of the resulting products can readily be removed by treatment with tetrabutylammonium fluoride. Thus, the net process provides an efficient method for the regio- and stereoselective synthesis of proximally dialkylated calix[4]arenes.     

Modular synthesis of triaroylbenzene-derived crownophanes

An isomeric series of homologous crownophanes (i.e., macrocycles possessing structural features of crown ethers and cyclophanes) has been prepared via a concise and modular synthetic route. Macrocyclization is achieved in reasonable yield during the course of an enaminone-triggered benzannulation with bis(aryl ethynyl ketone) reaction partners. The crownophanes examined were active alkali cation binding agents in the gas phase, but failed to exhibit ionophoric properties in solution. On the basis of X-ray crystallographic analysis, it is concluded that the cyclophane framework of these macrocycles is too large and rigid to allow efficient interaction with the cations examined.     

Selectivity in the photodimerization of 6-alkylcoumarins

Coumarin and 6-alkylcoumarins (alkyl = C(1) to C(16)) were photodimerized in homogeneous solvents differing in polarity and in aqueous micellar solutions. The four possible photodimers, syn head-to-head (hh), anti head-to-head, syn head-to-tail (ht), and anti head-to-tail, were identified through a combination of X-ray analysis and NMR spectroscopy. In 6-methylcoumarin the concentration-corrected dimerization (quantum) yield increases with decreasing concentration of the educt; anti-hh was formed exclusively in nonpolar solvents and upon triplet sensitization and was the main product under all conditions except for ionic micellar systems, which direct to preferred syn-hh dimerization. Long alkyl substituents, however, lead to anti-hh in polar solvents and in micelles, too. Predominating ht dimer formation was observed for nonsubstituted coumarin in polar solvents only. Thus, syn/anti and hh/ht selectivity can be steered by varying the 6-alkyl substituent. Syn-hh photodimers of 6-methylcoumarin can be photochemically split into the monomers; they partly proved thermally unstable against acids, bases, methanol, and on SiO(2) surfaces.     

Tri- and tetraurea piperazine cyclophanes: synthesis and complexation studies of preorganized and folded receptor molecules

A series of symmetrical tri‐ and tetrameric N‐ethyl‐ and N‐phenylurea‐functionalized cyclophanes have been prepared in nearly quantitative yields (86–99 %) from the corresponding tri‐ and tetraamino‐functionalized piperazine cyclophanes and ethyl or phenyl isocyanates. Their conformational and complexation properties have been studied by single‐crystal X‐ray diffraction, variable‐temperature NMR spectroscopy, and ESI‐MS analysis. The rigid 27‐membered trimeric cyclophane skeleton assisted by a seam of intramolecular hydrogen bonds results in a preorganized ditopic recognition site with an all‐syn conformation of the urea moieties that, complemented by a lipophilic cavity of the cyclophane, binds molecular and ionic guests as well as ion pairs. The all‐syn conformation persists in acidic conditions and the triprotonated triurea cyclophane binds an unprecedented anion pair, H₂PO₄^????HPO₄^2?, in the solid state. The tetra‐N‐ethylurea cyclophane is less rigid and demonstrates an induced‐fit recognition of diisopropyl ether in the solid state. The guest was encapsulated within the lipophilic interior of a quasicapsule, formed by intramolecular hydrogen‐bond‐driven folding of the 36‐membered cyclophane skeleton. In the gas phase, the essential role of the urea moieties in the binding was demonstrated by the formation of monomeric 1:1 complexes with K⁺, TMA⁺, and TMP⁺ as well as the ion‐pair complexes [KI+K]⁺, [TMABr+TMA]⁺ and [TMPBr+TMP]⁺. In the positive‐mode ESI‐MS analysis, ion‐pair binding was found to be more pronounced with the larger tetraurea cyclophanes. In the negative mode, owing to the large size of the binding site, a general binding preference towards larger anions, such as the iodide, over smaller anions, such as the fluoride, was observed.     

Complexation of fullerenes with 5,5'-Biscalix

5,5'-Biscalix[5]arene, prepared by oxidative coupling of the tetrabenzoyl ester of calix[5]arene (shown by X-ray crystallographic analysis to have a o,u,u,d,u conformation), forms complexes with C(60) (K(assoc) = 43 M(-)(1)) and C(70) (K(assoc) = 233 M(-)(1)). The X-ray crystallographic structure of the C(60) complex reveals its clamshell-shaped architecture, presumably the result of a change in the conformation of biscalix[5]arene from anti (uncomplexed) to syn (complexed).     

Dinuclear gold(I) complexes of bridging bidentate carbene ligands: synthesis, structure and spectroscopic characterisation

Eight dinuclear Au(i)-carbene complexes have been synthesized from various imidazolium-linked cyclophanes and related acyclic bis(imidazolium) salts, by treatment of the imidazolium salts with [Au(i)(SMe(2))Cl] in the presence of a carboxylate base. Single crystal structural studies showed that the Au(i)-carbene compounds contain dinuclear (AuL)(2) cations in which a pair of gold(i) centres are linked by a pair of bridging dicarbenoid ligands. Interestingly, the structural studies revealed short AuAu contacts of 3.0485(3)[Angstrom] and 3.5425(6)[Angstrom] in two of these complexes. NMR studies showed that the (AuL)(2) cations constructed from the cyclophane-based ligands retain a relatively rigid structure in solution, whilst those of the non-cyclophane ligand systems are fluxional in solution. The electronic absorption and emission spectra of the complexes in solution at room temperature were recorded and the complex with the shortest AuAu contact was found to emit intensely at 400 nm and more weakly at 780 nm upon excitation at 260 nm. The compounds with longer AuAu separations were not emissive under these conditions.     

Computational and experimental evidence for the structural preference of phenolic C-8 purine adducts

The structural and spectral properties of (ortho and para) C8-aryl-purine adducts formed from carbon attachment by phenolic toxins were investigated through DFT calculations and UV-vis absorbance and emission studies. The global minima of both the deoxyadenosine (dA) and deoxyguanosine (dG) adducts adopted a syn conformation about the glycosidic bond due to the presence of an O5'-H...N3 hydrogen bond, where the anti minima are 20-30 kJ mol-1 higher in energy. While the nucleobase adducts are planar, the presence of the deoxyribose sugar induces a twist about the carbon-carbon bond connecting the phenol and nucleobase rings. ortho-Phenolic adducts are less twisted than the corresponding para adducts due to stabilization provided by an intramolecular O-H...N7 bond. Solvation calculations, in combination with UV-vis studies, demonstrate that the structural preference is solvent dependent, where solvents with hydrogen-bonding abilities disrupt the intramolecular O-H...N7 hydrogen bond such that a greater degree of twist is observed, and less polar solvents stabilize the planar structure. Indeed, the ratio of twisted to planar conformers is estimated to be as large as 50:50 in some aprotic solvents. Thus, the combined experimental and computational approach has provided a greater understanding of the structure of the ortho- and para-dA and dG C-bonded phenoxyl adducts as the first step to understanding the biological consequences of this form of DNA damage.     

Cyclophanes of perylene tetracarboxylic diimide with different substituents at bay positions

Cyclophanes of perylene tetracarboxylic diimides (PDIs) with different substituents at the bay positions, namely four phenoxy groups at the 1,7-positions (1), four piperidinyl groups at the 1,7-positions (2), and eight phenoxy groups at the 1,6,7,12-positions (3) of the two PDI rings, have been synthesized by the condensation of perylene dianhydride with amine in a dilute solution. These novel cyclophanes were characterized by (1)H NMR spectroscopy, MALDI-TOF mass spectrometry, electronic absorption spectroscopy, and elemental analysis. The conformational isomers of cyclophanes substituted with four piperidinyl groups at the 1,7-positions (2 a and 2 b) were successfully separated by preparative TLC. The main absorption band of the cyclophanes shifts significantly to the higher energy side in comparison with their monomeric counterparts, which indicates significant pi-pi interaction between the PDI units in the cyclophanes. Nevertheless, both the electronic absorption and fluorescence spectra of the cyclophanes were found to change along with the number and nature of the side groups at the bay positions of the PDI ring. Time-dependent DFT calculations on the conformational isomers 2 a and 2 b reproduce well their experimental electronic absorption spectra. Electrochemical studies reveal that the first oxidation and reduction potentials of the PDI ring in the cyclophanes increase significantly compared with those of the corresponding monomeric counterparts, in line with the change in the energy of the HOMO and LUMO according to the theoretical calculations.     

Coumarin‐tethered (benz)imidazolium salts and their silver(I) N‐heterocyclic carbene complexes: Synthesis,characterization, crystal structure and antibacterial studies

A series of new sterically modulated chlorocoumarin‐substituted (benz)imidazolium salts and their bis‐N‐heterocyclic carbene silver(I) complexes were prepared and characterized. The complexes were prepared in good yields following the in situ deprotonation method by treating azolium salts with silver(I) oxide in the dark. All the compounds were characterized using various spectroscopic and analytical methods. Additionally, one of the benzimidazolium salts was characterized using single‐crystal X‐ray diffraction technique. In this salt, intermolecular π–π stacking interactions operate between benzimidazole as well as coumarin heterocyclic systems with adjacent molecules. In the preliminary antibacterial studies, the silver complexes were found more active than the corresponding salts against a panel of bacterial strains. Interestingly, the complexes displayed improved antibacterial efficacy against Escherichia coli strain, comparable with that of the standard drug ampicillin.     

An enaminone-directed benzannulation/macrocyclization approach to cyclophane ring systems

A straightforward and modular preparative approach to 1,3,5-triaroylbenzene-based functionalized cyclophane ring systems has been developed. The key cyclophane-forming macrocyclization reaction was accomplished during the course of a regioselective cross-benzannulation between bis(aryl ethynyl) ketone and enaminone reactants. Macrocyclic products with ring sizes ranging from 18- to 22-membered were successfully constructed. The composition of the tether connecting the two aryl ethynyl ketone fragments can be easily varied; consequently, this method is suitable for construction of a diverse range of structurally distinct cyclophane products. To illustrate this feature, cyclophanes possessing xylyl, alkyl, di(ethylene triamine), and di(ethylene oxy) bridging units were synthesized in isolated yields of 11-46%. Three new cyclophanes (calixarene-like macrocyles 8 and 9, as well as crownophane 18) were structurally characterized by X-ray diffractometry.     

Syntheses and structures of isomeric [6.6]- and [8.8]cyclophanes with 1,4-dioxabut-2-yne and 1,6-dioxahexa-2,4-diyne bridges

All three isomers (ortho, meta, and para) of [8.8]cyclophane bearing 1,6-dioxahexa-2,4-diyne bridges have been synthesized and structually characterized by single-crystal X-ray crystallography to determine the conformation of the cyclophanes and their cavity dimensions. The three isomeric [6.6]cyclophanes bearing 1,4-dioxabut-2-yne bridges have also been synthesized from but-2-yne-1,4-diol ditosylate and the isomeric dihydroxybenzenes. The [6.6]orthocyclophane has been structurally characterized by single-crystal X-ray crystallography. The energy-minimized structures from the semiempirical AM1 calculations of these cyclophanes compare very well with the structures obtained by X-ray crystallography.     

Molecular saddles. 4. Redox-active cyclophanes by bridging the 9,10-bis(1,3-dithiol-2-ylidene)-9,10-dihydroanthracene system: synthesis, electrochemistry, and X-ray crystal structures of neutral species and a dication salt.

We report the synthesis of a new series of cyclophanes 11a-d by ester-forming macrocyclization reactions of diol 9 with the dicarbonyl chloride derivatives of benzene, thiophene, ferrocene, and diphenyl ether, 10a-d, respectively. Compounds 11a-d display a two-electron, quasireversible oxidation wave in the cyclic voltammogram to yield the dication species at Eoxpa = 0.70-0.72 V (for 11a-c) and 0.47 V (for 11d) (vs Ag/AgCl in acetonitrile). The raised oxidation potentials for 11a-c reflect the reduced stability of the twisted dication structure within the steric constraints of the smaller cyclophanes. Consistent with this, the value of delta E (defined as Eoxpa - Eoxpc) decreases (i.e., reversibility of the oxidation process increases) in the sequence 11d > 11c > 11a > 11b as the bridging chain becomes shorter. X-ray crystal structures are reported for compounds 11a-d and the dication salt 11d2+(I3-)2.(CH2Cl2)2.25. For 11a-d the typical saddle-shaped conformation of the 9,10-bis(1,3-dithiol-2-ylidene)-9,10-dihydroanthracene moiety is observed, with the strain imposed by the cyclophane ring being accommodated in the structure of the bridging unit. In the dication 11d2+ both dithiolium rings are planar and the anthracene unit is essentially aromatic, with the conformation of the bridge basically the same as in neutral 11d.