Phosphoramidite coupling to oligonucleotides bearing unprotected internucleosidic phosphate moieties

The coupling of 2-cyanoethyl thymidine phosphoramidite to solid-support-bound, phosphate-unprotected oligothymidylates and their phosphorothioate analogues was studied. The yield of the coupling reaction depended on the pK(BH)()+ values of protonated nitrogen bases that served as counterions to the phosphodiester functions of oligonucleotides. To maximize the coupling efficiency, the oligonucleotides were detritylated and washed with a mixture of 0.1 M DMAP and 0.1 M 1H-tetrazole, which resulted in a 98+% coupling efficiency. The utility of the results was demonstrated in the preparation of oligonucleotides with a mixed backbone that required the successive use of H-phosphonate and phosphoramidite methods of synthesis. Using this approach, 20-mer antisense oligonucleotides containing 2'-O-(2-methoxyethyl) ribonucleoside residues and phosphorothioate and phosphoramidate internucleosidic linkages were synthesized in high yield.     

Synthesis of 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] modified nucleosides and oligonucleotides.

A versatile synthetic route has been developed for the synthesis of 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] (abbreviated as 2'-O-DMAOE) modified purine and pyrimidine nucleosides and their corresponding nucleoside phosphoramidites and solid supports. To synthesize 2'-O-DMAOE purine nucleosides, the key intermediate B (Scheme 1) was obtained from the 2'-O-allyl purine nucleosides (13a and 15) via oxidative cleavage of the carbon-carbon bond to the corresponding aldehydes followed by reduction. To synthesize pyrimidine nucleosides, opening the 2,2'-anhydro-5-methyluridine 5 with the borate ester of ethylene glycol gave the key intermediate B. The 2'-O-(2-hydroxyethyl) nucleosides were converted, in excellent yield, by a regioselective Mitsunobu reaction, to the corresponding 2'-O-[2-[(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)oxy]ethyl] nucleosides (18, 19, and 20). These compounds were subsequently deprotected and converted into the 2'-O-[2-[(methyleneamino)oxy]ethyl] derivatives (22, 23, and 24). Reduction and a second reductive amination with formaldehyde yielded the corresponding 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] nucleosides (25, 26, and 27). These nucleosides were converted to their 3'-O-phosphoramidites and controlled-pore glass solid supports in excellent overall yield. Using these monomers, modified oligonucleotides containing pyrimidine and purine bases were synthesized with phosphodiester, phosphorothioate, and both linkages (phosphorothioate and phosphodiester) present in the same oligonucleotide as a chimera in high yields. The oligonucleotides were characterized by HPLC, capillary gel electrophoresis, and ESMS. The effect of this modification on the affinity of the oligonucleotides for complementary RNA and on nuclease stability was evaluated. The 2'-O-DMAOE modification enhanced the binding affinity of the oligonucleotides for the complementary RNA (and not for DNA). The modified oligonucleotides that possessed the phosphodiester backbone demonstrated excellent resistance to nuclease with t(1/2) > 24 h.     

2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] modified oligonucleotides: symbiosis of charge interaction factors and stereoelectronic effects

[structure: see text] Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.     

2-Benzamidoethyl group--a novel type of phosphate protecting group for oligonucleotide synthesis.

A number of 5'-O-(4,4'-dimethoxytrityl)thymidine N,N-diisopropylamino phosphoramidites protected at P(III) with derivatives of 2-benzamidoethanol were synthesized and incorporated into synthetic oligonucleotides. Depending on substitution patterns at the alkyl chain, amido group, and phenyl ring, the time required for removal of these protecting groups using concentrated ammonium hydroxide varied from 48 h at 55 degrees C to 25 min at 25 degrees C. Of the 11 groups studied, 2-[N-isopropyl-N- (4-methoxybenzoyl)amino]ethyl- (H) and omega-(thionobenzoylamino)alkyl protections (I and K) were most easily removed. Derivatives of the 2-[N-methyl-N-benzoylamino]ethyl group (E-G) demonstrated moderate stability, but those of the 2-(N-benzoylamino)ethyl group (A-C) were the most stable. For the most reactive group, H, a phosphitylating reagent, bisamidite 60, was synthesized and used in the preparation of four deoxynucleoside phosphoramidites 28 and 65-67, plus the 2'-O-(2-methoxyethyl)-5-methyluridine phosphoramidite 68. All of these novel building blocks were successfully tested in the preparation of natural, 20-mer oligonucleotides and their phosphorothioate analogues. With the model phosphotriester 37, the mechanism of deprotection was studied and revealed, in the case of group H, a pH-independent formation of the 2-oxazolinium cation 47. Under aqueous conditions, 47 gave 54, which in turn was converted in the presence of ammonia to a number of identified products. It is important to note that none of the products formed was reactive toward the oligonucleotide backbone or nucleic bases. Thus, a general strategy for protection of internucleosidic phosphodiester groups is described, which may also find application in synthetic organic chemistry of phosphorus(III) and (V).     

Efficient guanidination of the phosphate linkage towards cationic phosphoramidate oligonucleotides

An efficient postsynthesis method of guanidination of oligonucleotides was employed to introduce several guanidinium groups into internucleotide phosphoramidate linkages. The amino functions of aminobutylphosphoramidate links were converted to guanidine butylphosphoramidates using a solution of O-methylisourea hemisulfate in aqueous ammonia, in a short reaction time. The synthesis of various fully guanidylated oligonucleotides was successfully performed to provide a new class of cationic phosphoramidate oligonucleotides.     

A convenient synthesis of the cytidyl 3′-terminal monomer for solid-phase synthesis of RNG oligonucleotides

Replacing the phosphodiester backbone of RNA with positively charged guanidinium linkages has been shown to enable RNA oligomers to overcome electrostatic repulsion and bind double-stranded DNA in a triplex with high affinity. Ribonucleotide monomers with the ability to form guanidinium linkages have been synthesized for the generation of ribooligonucleotides with guanidinium linkages (RNGs) through solid-phase synthesis. We report herein an efficient method for the synthesis of N⁴-benzoyl-2′-O-(tert-butyldimethylsilyl)-5′-N-(4-monomethoxytritylamino)-3′-O-succinyl-5′-deoxycytidine, a new monomer required for the solid-phase synthesis of cytidyl RNG oligonucleotides.     

A phosphoramidate substrate analog is a competitive inhibitor of the Tetrahymena group I ribozyme

BACKGROUND: Phosphoramidate oligonucleotide analogs containing N3'-P5' linkages share many structural properties with natural nucleic acids and can be recognized by some RNA-binding proteins. Therefore, if the N-P bond is resistant to nucleolytic cleavage, these analogs may be effective substrate analog inhibitors of certain enzymes that hydrolyze RNA. We have explored the ability of the Tetrahymena group I intron ribozyme to bind and cleave DNA and RNA phosphoramidate analogs. RESULTS: The Tetrahymena group I ribozyme efficiently binds to phosphoramidate oligonucleotides but is unable to cleave the N3'-P5' bond. Although it adopts an A-form helical structure, the deoxyribo-phosphoramidate analog, like DNA, does not dock efficiently into the ribozyme catalytic core. In contrast, the ribo-phosphoramidate analog docks similarly to the native RNA substrate, and behaves as a competitive inhibitor of the group I intron 5' splicing reaction. CONCLUSIONS: Ribo-N3'-P5' phosphoramidate oligonucleotides are useful tools for structural and functional studies of ribozymes as well as protein-RNA interactions.     

Synthesis and properties of morpholino chimeric oligonucleotides

Chimeric oligonucleotides with the novel morpholino modification and the phosphoramidate linkers have been synthesized and characterized. These oligonucleotides showed moderate thermal stability with complementary RNA and DNA, and enhanced resistance toward the nuclease (t_1/2 > 10 h). The phosphoramidate linker made the synthesis of such oligonucleotides applicable on a DNA synthesizer. Under the acidic condition (pH 3.0), the phosphoramidate linkers were readily cleaved, and such property might be useful for the DNA-sequence determination.     

Cleavage of oligonucleotides containing a P3'→N5' phosphoramidate linkage mediated by single-stranded oligonucleotide templates

Double-stranded DNA (dsDNA) templates can hybridize to and accelerate cleavage of oligonucleotides containing a P3'→N5' phosphoramidate (P-N) linkage. This dsDNA-templated cleavage of P-N linkages could be due to conformational strain placed on the linkage upon triplex formation. To determine whether duplex formation also induced conformational strain, we examined the reactivity of the oligonucleotides with a P-N linkage in the presence of single-stranded templates, and compared these reactions to those with dsDNA templates. P-N oligonucleotides that are cleaved upon duplex formation could be used as probes to detect single-stranded nucleic acids.     

2'-O-[2-[N,N-(dialkyl)aminooxy]ethyl]-modified antisense oligonucleotides

[structure] Oligonucleotides with two novel modifications, 2'-O-?2-[N, N-(dimethyl)aminooxy]ethyl? (2'-O-DMAOE) and 2'-O-?2-[N, N-(diethyl)aminooxy]ethyl? (2'-O-DEAOE), have been synthesized. These modifications exhibit high binding affinity to target RNA (and not to DNA) and enhance the nuclease stability of oligonucleotides considerably with t(1/2) > 24 h as a phosphodiester.     

DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY - HIGH RESOLUTION MASS SPECTROMETRY

An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described.Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3'-terminal phosphate monoester and 3'-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N(3) (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling.     

Synthesis of novel 3'-C-methylene thymidine and 5-methyluridine/cytidine H-phosphonates and phosphonamidites for new backbone modification of oligonucleotides

Novel 5'-O-DMT- and MMT-protected 3'-C-methylene-modified thymidine, 5-methyluridine, and 5-methylcytidine H-phosphonates 1-7 with O-methyl, fluoro, hydrogen, and O-(2-methoxyethyl) substituents at the 2'-position have been synthesized by a new effective strategy from the corresponding key intermediates 3'-C-iodomethyl nucleosides and intermediate BTSP, prepared in situ through the Arbuzov reaction. The modified reaction conditions for the Arbuzov reaction prevented the loss of DMT- and MMT-protecting groups, and directly provided the desired 5'-O-DMT- and/or MMT-protected 3'-C-methylene-modified H-phosphonates 1-6 although some of them were also prepared through the manipulation of protecting groups after the P-C bond formation. The modified Arbuzov reaction of 3'-C-iodomethyl-5-methylcytidine 53, prepared from its 5-methyluridine derivative 42, with BTSP provided the 5-methylcytidine H-phosphonate 54, which was further transferred to the corresponding 4-N-(N-methylpyrrolidin-2-ylidene)-protected H-phosphonate monomer 7. 5'-O-MMT-protected 3'-C-methylene-modified H-phosphonates 5, 3, and 7 were converted to the corresponding cyanoethyl H-phosphonates 50, 51, and 56 using DCC as a coupling reagent. One-pot three-step reactions of 50, 51, and 56 provided the desired 3'-C-methylene-modified phosphonamidite monomers 8-10. Some of these new 3'-methylene-modified monomers 1-10 have been successfully utilized for the synthesis of 3'-methylene-modified oligonucleotides, which have shown superior antisense properties including nuclease resistance and binding affinity to the target RNA.     

2'-O-[2-(amino)-2-oxoethyl] oligonucleotides

[structure: see text] Oligonucleotides with novel modifications, 2'-O-[2-(amino)-2-oxoethyl] (2'-O-NAc), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMAc), 2'-O-[2-(dimethylamino)-2-oxoethyl] (2'-O-DMAc), and 2'-O-[2-[[2-(dimethylamino)ethyl]amino]-2-oxoethyl] (2'-O-DMAEAc), have been synthesized. These modified oligonucleotides exhibit high binding affinity to complementary RNA (and not to DNA) and considerably enhance the nuclease stability of oligonucleotides with t(1/2) > 24 h.     

Chemical Phosphorylation of Nucleosomes and Histone H4

Using N,N′-Dicyclohexylcarbodiimide (DCC) as a condensing agent, ³²P-cyanoethylphosphate and NH₃ were combined to yield ³²P-cyanoethylphosphoramidate. Treatment with NaOH resulted in a β-elimination step to yield ³²P-phosphoramidate and acrylonitrile. The phosphoramidate was purified via DEAE-cellulose chromatography. At pH 7.4 the histidine residues of histone H4 were chemically phosphorylated using ³²P-phosphoramidate as the phosphoryl donor. The nucleophilic nitrogen of the imidazole ring is attracted to the phosphorus of phosphoramidate resulting in the displacement of NH₃ and formation of the protein phosphoryl-nitrogen linkages. Chromatin monomers (nucleosomes) were prepared by a mild digestion of chromatin with micrococcal nuclease. This report also presents the chemical phosphorylation of these nucleosomes by ³²P-phosphoramidate.     

High-affinity DNA targeting using readily accessible mimics of N2'-functionalized 2'-amino-α-L-LNA

N2'-Pyrene-functionalized 2'-amino-α-L-LNAs (locked nucleic acids) display extraordinary affinity toward complementary DNA targets due to favorable preorganization of the pyrene moieties for hybridization-induced intercalation. Unfortunately, the synthesis of these monomers is challenging (~20 steps, <3% overall yield), which has precluded full characterization of DNA-targeting applications based on these materials. Access to more readily accessible functional mimics would be highly desirable. Here we describe short synthetic routes to a series of O2'-intercalator-functionalized uridine and N2'-intercalator-functionalized 2'-N-methyl-2'-aminouridine monomers and demonstrate, via thermal denaturation, UV-vis absorption and fluorescence spectroscopy experiments, that several of them mimic the DNA-hybridization properties of N2'-pyrene-functionalized 2'-amino-α-L-LNAs. For example, oligodeoxyribonucleotides (ONs) modified with 2'-O-(coronen-1-yl)methyluridine monomer Z, 2'-O-(pyren-1-yl)methyluridine monomer Y, or 2'-N-(pyren-1-ylmethyl)-2'-N-methylaminouridine monomer Q display prominent increases in thermal affinity toward complementary DNA relative to reference strands (average ΔT(m)/mod up to +12 °C), pronounced DNA-selectivity, and higher target specificity than 2'-amino-α-L-LNA benchmark probes. In contrast, ONs modified with 2'-O-(2-napthyl)uridine monomer W, 2'-O-(pyren-1-yl)uridine monomer X or 2'-N-(pyren-1-ylcarbonyl)-2'-N-methylaminouridine monomer S display very low affinity toward DNA targets. This demonstrates that even conservative alterations in linker chemistry, linker length, and surface area of the appended intercalators have marked impact on DNA-hybridization characteristics. Straightforward access to high-affinity building blocks such as Q, Y, and Z is likely to accelerate their use in DNA-targeting applications within nucleic acid based diagnostics, therapeutics, and material science.     

Template-free segmental synthesis of oligonucleotides containing nonnative linkages

Protected oligonucleotides containing 3'-alkyl carboxylic acids or 3'-alkylamines were obtained from photolabile solid-phase synthesis supports (1 and 4). Protected oligonucleotides containing 5'-alkylamines and 3'-hydroxyl groups were obtained using a photolabile solid-phase synthesis support (2) and a commercially available phosphoramidite reagent (3). Depending upon the source of alkylamine-containing oligonucleotide, the segments were coupled under mild conditions to form products containing either 5'-3' or 3'-3' linkages in good yield and high purity. Oligonucleotides as long as 40 nucleotides were prepared, and coupling yields of protected biopolymer segments were independent of length over the range examined. This method is particularly well suited for the convergent synthesis of oligonucleotides containing nonnative linkages and should be useful for the rapid assembly of modified biopolymers that are useful in biochemical studies.     

Free solution mobility of DNA molecules containing variable numbers of cationic phosphoramidate internucleoside linkages

The free solution electrophoretic mobility of an 118-base pair DNA fragment containing zero, three, six or nine cationic phosphoramidate internucleoside linkages has been measured by capillary electrophoresis. The electrophoretic mobility decreases with the increasing number of cationic phosphoramidate linkages, as expected because of the reduced negative charge on the DNA molecules. The decrease in mobility is approximately linear for DNA molecules containing three and six cationic phosphoramidate linkages, but begins to level off when nine cationic phosphoramidate linkages have been added. The mobility also varies somewhat depending on whether the modified phosphoramidate linkages are located at the 5'- or 3'-end of the DNA molecule.     

Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides

The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.     

Thermolytic properties of 3-(2-pyridyl)-1-propyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl phosphate/thiophosphate protecting groups in solid-phase synthesis of oligodeoxyribonucleotides

Thermolytic groups may serve as alternatives to the conventional 2-cyanoethyl group for phosphate/thiophosphate protection in solid-phase oligonucleotide synthesis to prevent DNA alkylation by acrylonitrile generated under the basic conditions used for oligonucleotide deprotection. Additionally, thermolytic groups are attractive in the context of engineering a "heat-driven" process for the synthesis of oligonucleotides on diagnostic microarrays. In these regards, the potential application of pyridine derivatives as thermolytic phosphate/thiophosphate protecting groups has been investigated. Specifically, 2-pyridinepropanol and 2-[N-methyl-N-(2-pyridyl)]aminoethanol were incorporated into deoxyribonucleoside phosphoramidites 7a-d and 9, which were found as efficient as 2-cyanoethyl deoxyribonucleoside phosphoramidites in solid-phase oligonucleotide synthesis. Whereas the removal of 3-(2-pyridyl)-1-propyl phosphate/thiophosphate protecting groups from oligonucleotides is effected within 30 min upon heating at 55 degrees C in concentrated NH4OH or in an aqueous buffer at pH 7.0, cleavage of 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotide synthesis. The deprotection of these groups follows a cyclodeesterification process generating the bicyclic salts 13 and 14 as side products. These salts do not alkylate or otherwise modify any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimicking large-scale oligonucleotide deprotection.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).